Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640527_at:

>probe:Drosophila_2:1640527_at:133:337; Interrogation_Position=1015; Antisense; GCTGCGCAACGAGGACAAGATTCGT
>probe:Drosophila_2:1640527_at:334:295; Interrogation_Position=1024; Antisense; CGAGGACAAGATTCGTGGTCACTAT
>probe:Drosophila_2:1640527_at:331:397; Interrogation_Position=1028; Antisense; GACAAGATTCGTGGTCACTATGTGC
>probe:Drosophila_2:1640527_at:669:257; Interrogation_Position=1043; Antisense; CACTATGTGCCCAAAGTTGGCGTGT
>probe:Drosophila_2:1640527_at:242:301; Interrogation_Position=1052; Antisense; CCCAAAGTTGGCGTGTGAGCAGCAA
>probe:Drosophila_2:1640527_at:346:351; Interrogation_Position=1070; Antisense; GCAGCAAAGCTGCAGTTATTTAGTT
>probe:Drosophila_2:1640527_at:700:205; Interrogation_Position=1076; Antisense; AAGCTGCAGTTATTTAGTTATTAAA
>probe:Drosophila_2:1640527_at:557:361; Interrogation_Position=906; Antisense; GCAAGGCCAAGAACCGCTCCCGCAA
>probe:Drosophila_2:1640527_at:342:89; Interrogation_Position=934; Antisense; AGTCATGATGATCCTGCGTCGCAAC
>probe:Drosophila_2:1640527_at:361:647; Interrogation_Position=936; Antisense; TCATGATGATCCTGCGTCGCAACCC
>probe:Drosophila_2:1640527_at:232:501; Interrogation_Position=951; Antisense; GTCGCAACCCCAATTTCGATCTGGA
>probe:Drosophila_2:1640527_at:528:243; Interrogation_Position=962; Antisense; AATTTCGATCTGGATGTGCTGCGTC
>probe:Drosophila_2:1640527_at:660:715; Interrogation_Position=965; Antisense; TTCGATCTGGATGTGCTGCGTCGCC
>probe:Drosophila_2:1640527_at:465:623; Interrogation_Position=981; Antisense; TGCGTCGCCAGTTCCCCGATGTCAA

Paste this into a BLAST search page for me
GCTGCGCAACGAGGACAAGATTCGTCGAGGACAAGATTCGTGGTCACTATGACAAGATTCGTGGTCACTATGTGCCACTATGTGCCCAAAGTTGGCGTGTCCCAAAGTTGGCGTGTGAGCAGCAAGCAGCAAAGCTGCAGTTATTTAGTTAAGCTGCAGTTATTTAGTTATTAAAGCAAGGCCAAGAACCGCTCCCGCAAAGTCATGATGATCCTGCGTCGCAACTCATGATGATCCTGCGTCGCAACCCGTCGCAACCCCAATTTCGATCTGGAAATTTCGATCTGGATGTGCTGCGTCTTCGATCTGGATGTGCTGCGTCGCCTGCGTCGCCAGTTCCCCGATGTCAA

Full Affymetrix probeset data:

Annotations for 1640527_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime