FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640528_at:

>probe:Drosophila_2:1640528_at:387:695; Interrogation_Position=2859; Antisense; TTTCCAATCTCTACAATTCGCCATT
>probe:Drosophila_2:1640528_at:483:9; Interrogation_Position=2874; Antisense; ATTCGCCATTAGTTGTTAACTTGAC
>probe:Drosophila_2:1640528_at:500:601; Interrogation_Position=2912; Antisense; TGTTGCAATAATTCGAGAGTATCGT
>probe:Drosophila_2:1640528_at:231:1; Interrogation_Position=2950; Antisense; CTTTCTAACGAATAAGTAGTGCCCT
>probe:Drosophila_2:1640528_at:304:485; Interrogation_Position=2965; Antisense; GTAGTGCCCTTAGTGATTTGTCTCC
>probe:Drosophila_2:1640528_at:524:459; Interrogation_Position=2979; Antisense; GATTTGTCTCCTACAGAATTATTCA
>probe:Drosophila_2:1640528_at:182:489; Interrogation_Position=3041; Antisense; GTACTTAGCAATTAGCGCAGCTTTA
>probe:Drosophila_2:1640528_at:593:703; Interrogation_Position=3106; Antisense; TTAAAGTGCTTAGCCTTAGCCACCG
>probe:Drosophila_2:1640528_at:183:255; Interrogation_Position=3166; Antisense; CAAAGGTATCAAGCATTAGTACATA
>probe:Drosophila_2:1640528_at:673:665; Interrogation_Position=3185; Antisense; TACATACATAATTGCTAGCGTACAA
>probe:Drosophila_2:1640528_at:64:213; Interrogation_Position=3214; Antisense; AAGACAACCCACAAGTCGCTTTGAT
>probe:Drosophila_2:1640528_at:175:503; Interrogation_Position=3228; Antisense; GTCGCTTTGATGTATTATGTTTTTA
>probe:Drosophila_2:1640528_at:426:613; Interrogation_Position=3293; Antisense; TGAACTACAAAACACCAACGGAAAT
>probe:Drosophila_2:1640528_at:229:273; Interrogation_Position=3413; Antisense; CATTTTTATGATTTTCTCGAAACGA

Paste this into a BLAST search page for me
TTTCCAATCTCTACAATTCGCCATTATTCGCCATTAGTTGTTAACTTGACTGTTGCAATAATTCGAGAGTATCGTCTTTCTAACGAATAAGTAGTGCCCTGTAGTGCCCTTAGTGATTTGTCTCCGATTTGTCTCCTACAGAATTATTCAGTACTTAGCAATTAGCGCAGCTTTATTAAAGTGCTTAGCCTTAGCCACCGCAAAGGTATCAAGCATTAGTACATATACATACATAATTGCTAGCGTACAAAAGACAACCCACAAGTCGCTTTGATGTCGCTTTGATGTATTATGTTTTTATGAACTACAAAACACCAACGGAAATCATTTTTATGATTTTCTCGAAACGA

Full Affymetrix probeset data:

Annotations for 1640528_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720