FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640529_at:

>probe:Drosophila_2:1640529_at:344:39; Interrogation_Position=1000; Antisense; ATCTGCGGACGAAAGCTACTCATGC
>probe:Drosophila_2:1640529_at:467:261; Interrogation_Position=1059; Antisense; GGCCTTCGGATTCTTTACCAAATAT
>probe:Drosophila_2:1640529_at:128:609; Interrogation_Position=1104; Antisense; TGAGTACAGCTGGATACCCCTGCTA
>probe:Drosophila_2:1640529_at:445:61; Interrogation_Position=1132; Antisense; ATGTCCATGGACATCTTTCTGGGCA
>probe:Drosophila_2:1640529_at:541:619; Interrogation_Position=1174; Antisense; TGCTTCTTTGTCAGCCTTGTGGAAA
>probe:Drosophila_2:1640529_at:685:165; Interrogation_Position=1196; Antisense; AAATGTTCCCCGTCAAGATTCGTGC
>probe:Drosophila_2:1640529_at:372:227; Interrogation_Position=1222; Antisense; AAGGCCGCCTCAATGGCAATTGTGG
>probe:Drosophila_2:1640529_at:540:385; Interrogation_Position=1275; Antisense; GAACATATTCCCGATCTGCATGAAG
>probe:Drosophila_2:1640529_at:671:513; Interrogation_Position=1337; Antisense; GTGTCACAGCACTAAGTTCCCTTTA
>probe:Drosophila_2:1640529_at:294:131; Interrogation_Position=828; Antisense; ACCTGCTCTGGTGCTTTTAATTGCC
>probe:Drosophila_2:1640529_at:26:91; Interrogation_Position=857; Antisense; AGTTTAGCGGACTTTTCACCATGGT
>probe:Drosophila_2:1640529_at:322:61; Interrogation_Position=889; Antisense; ATGTCGGACATATTCGCCAACTCTG
>probe:Drosophila_2:1640529_at:397:455; Interrogation_Position=931; Antisense; GATACGTGCACCATCATCATTGGAG
>probe:Drosophila_2:1640529_at:703:511; Interrogation_Position=979; Antisense; GTGACCACTTTGTTGTGCGACATCT

Paste this into a BLAST search page for me
ATCTGCGGACGAAAGCTACTCATGCGGCCTTCGGATTCTTTACCAAATATTGAGTACAGCTGGATACCCCTGCTAATGTCCATGGACATCTTTCTGGGCATGCTTCTTTGTCAGCCTTGTGGAAAAAATGTTCCCCGTCAAGATTCGTGCAAGGCCGCCTCAATGGCAATTGTGGGAACATATTCCCGATCTGCATGAAGGTGTCACAGCACTAAGTTCCCTTTAACCTGCTCTGGTGCTTTTAATTGCCAGTTTAGCGGACTTTTCACCATGGTATGTCGGACATATTCGCCAACTCTGGATACGTGCACCATCATCATTGGAGGTGACCACTTTGTTGTGCGACATCT

Full Affymetrix probeset data:

Annotations for 1640529_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720