Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640530_at:

>probe:Drosophila_2:1640530_at:44:463; Interrogation_Position=1018; Antisense; GATTCAGGAGCGTTTGCTACACACG
>probe:Drosophila_2:1640530_at:335:655; Interrogation_Position=1056; Antisense; TAATGAGGCCCTGGCGATTATGCGC
>probe:Drosophila_2:1640530_at:642:477; Interrogation_Position=1083; Antisense; GTTTAAGCAAGACATCTGGCCCCAT
>probe:Drosophila_2:1640530_at:509:575; Interrogation_Position=1100; Antisense; GGCCCCATCTAATCCTTACGATAAT
>probe:Drosophila_2:1640530_at:706:701; Interrogation_Position=1115; Antisense; TTACGATAATTTTCTCCGGCCCTAT
>probe:Drosophila_2:1640530_at:165:273; Interrogation_Position=1149; Antisense; CATTATTGCCCTGCCTTATATTTGG
>probe:Drosophila_2:1640530_at:653:691; Interrogation_Position=1169; Antisense; TTTGGCGTCGACGATGGGCGAACTC
>probe:Drosophila_2:1640530_at:656:117; Interrogation_Position=1265; Antisense; AGCTCAAACCCAGAACTGTGCTGTC
>probe:Drosophila_2:1640530_at:640:343; Interrogation_Position=1325; Antisense; GCATATGGTTCACTTTACGTCTGTT
>probe:Drosophila_2:1640530_at:448:163; Interrogation_Position=1375; Antisense; AAATTTATTTCCGTTGTCACAGTAG
>probe:Drosophila_2:1640530_at:651:575; Interrogation_Position=1412; Antisense; GGCGAACGCATAAGCACTGTCTTCA
>probe:Drosophila_2:1640530_at:203:331; Interrogation_Position=1442; Antisense; GCGGCAAATGCTTTGGCCTACGCAT
>probe:Drosophila_2:1640530_at:636:141; Interrogation_Position=978; Antisense; ACGGCGGAAGGCCATCGAGTTCTCT
>probe:Drosophila_2:1640530_at:252:93; Interrogation_Position=995; Antisense; AGTTCTCTTTTTTCACACTGGCTGA

Paste this into a BLAST search page for me
GATTCAGGAGCGTTTGCTACACACGTAATGAGGCCCTGGCGATTATGCGCGTTTAAGCAAGACATCTGGCCCCATGGCCCCATCTAATCCTTACGATAATTTACGATAATTTTCTCCGGCCCTATCATTATTGCCCTGCCTTATATTTGGTTTGGCGTCGACGATGGGCGAACTCAGCTCAAACCCAGAACTGTGCTGTCGCATATGGTTCACTTTACGTCTGTTAAATTTATTTCCGTTGTCACAGTAGGGCGAACGCATAAGCACTGTCTTCAGCGGCAAATGCTTTGGCCTACGCATACGGCGGAAGGCCATCGAGTTCTCTAGTTCTCTTTTTTCACACTGGCTGA

Full Affymetrix probeset data:

Annotations for 1640530_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime