FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640531_at:

>probe:Drosophila_2:1640531_at:322:663; Interrogation_Position=115; Antisense; TAAACTGCGTTTCGTTGTTGCTGCT
>probe:Drosophila_2:1640531_at:703:623; Interrogation_Position=154; Antisense; TGCGCTGGGAACTCGACGGTTTGAT
>probe:Drosophila_2:1640531_at:45:459; Interrogation_Position=176; Antisense; GATTTACAATTTGGTGGCCCGTACT
>probe:Drosophila_2:1640531_at:170:521; Interrogation_Position=189; Antisense; GTGGCCCGTACTAATGGTGCATTTG
>probe:Drosophila_2:1640531_at:45:275; Interrogation_Position=214; Antisense; CATTGGCCTTGCATTTACTGGGAAT
>probe:Drosophila_2:1640531_at:429:87; Interrogation_Position=244; Antisense; AGTGCCTGCGCGAAATAAGCTTTTT
>probe:Drosophila_2:1640531_at:156:471; Interrogation_Position=294; Antisense; GTTCCGACGTGACATGATTTCCGCA
>probe:Drosophila_2:1640531_at:489:695; Interrogation_Position=311; Antisense; TTTCCGCACTTTTCAGTACTGGCAA
>probe:Drosophila_2:1640531_at:501:563; Interrogation_Position=331; Antisense; GGCAATTTTCCAGACCTTAAGTGTT
>probe:Drosophila_2:1640531_at:168:465; Interrogation_Position=353; Antisense; GTTGGATAACGTTTTGCTTCTAGAG
>probe:Drosophila_2:1640531_at:354:99; Interrogation_Position=450; Antisense; AGAGGCAAAGGCTTCCGCTGGAAAA
>probe:Drosophila_2:1640531_at:189:607; Interrogation_Position=488; Antisense; TGATGCAGCACGTTTTTCCATTGGT
>probe:Drosophila_2:1640531_at:720:433; Interrogation_Position=565; Antisense; GAGGGATTAGTCCAGTTCTCCCAGC
>probe:Drosophila_2:1640531_at:375:401; Interrogation_Position=613; Antisense; GACATGGAAATCGTACGCCTGCGCA

Paste this into a BLAST search page for me
TAAACTGCGTTTCGTTGTTGCTGCTTGCGCTGGGAACTCGACGGTTTGATGATTTACAATTTGGTGGCCCGTACTGTGGCCCGTACTAATGGTGCATTTGCATTGGCCTTGCATTTACTGGGAATAGTGCCTGCGCGAAATAAGCTTTTTGTTCCGACGTGACATGATTTCCGCATTTCCGCACTTTTCAGTACTGGCAAGGCAATTTTCCAGACCTTAAGTGTTGTTGGATAACGTTTTGCTTCTAGAGAGAGGCAAAGGCTTCCGCTGGAAAATGATGCAGCACGTTTTTCCATTGGTGAGGGATTAGTCCAGTTCTCCCAGCGACATGGAAATCGTACGCCTGCGCA

Full Affymetrix probeset data:

Annotations for 1640531_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720