FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640532_at:

>probe:Drosophila_2:1640532_at:479:71; Interrogation_Position=108; Antisense; AGGCGACGTCAATCAGTGGACATTC
>probe:Drosophila_2:1640532_at:724:463; Interrogation_Position=152; Antisense; GATTGCAATGGACGCAACCCGTTCT
>probe:Drosophila_2:1640532_at:633:645; Interrogation_Position=178; Antisense; TCAGTTTCTGGCCTACTTTCGAAAA
>probe:Drosophila_2:1640532_at:410:167; Interrogation_Position=200; Antisense; AAATGTTCCAACAACTGCCTTGGCC
>probe:Drosophila_2:1640532_at:81:579; Interrogation_Position=221; Antisense; GGCCACTTGCCGTCGGATCGGGTAA
>probe:Drosophila_2:1640532_at:562:529; Interrogation_Position=240; Antisense; GGGTAACTCTAATTGCCGGCAAGGT
>probe:Drosophila_2:1640532_at:168:107; Interrogation_Position=288; Antisense; AGAAAGAACCCTTTATCGCTGCTGC
>probe:Drosophila_2:1640532_at:479:335; Interrogation_Position=305; Antisense; GCTGCTGCGCGAAGATTTAACTACA
>probe:Drosophila_2:1640532_at:329:659; Interrogation_Position=322; Antisense; TAACTACACGTATCGATCGCGGAGC
>probe:Drosophila_2:1640532_at:714:387; Interrogation_Position=348; Antisense; GAAAAGTCAACTGGGTCCTGGCGCA
>probe:Drosophila_2:1640532_at:565:359; Interrogation_Position=370; Antisense; GCAACTGCGAAAATCCGCTGCTGGG
>probe:Drosophila_2:1640532_at:136:235; Interrogation_Position=399; Antisense; AATGCCGACCACAGGCACAGTGGAT
>probe:Drosophila_2:1640532_at:155:607; Interrogation_Position=462; Antisense; TGAGGAACCTTCTCGACCTGGATCA
>probe:Drosophila_2:1640532_at:188:493; Interrogation_Position=77; Antisense; GTAAGGTCGGCCCATTGCAACAGTG

Paste this into a BLAST search page for me
AGGCGACGTCAATCAGTGGACATTCGATTGCAATGGACGCAACCCGTTCTTCAGTTTCTGGCCTACTTTCGAAAAAAATGTTCCAACAACTGCCTTGGCCGGCCACTTGCCGTCGGATCGGGTAAGGGTAACTCTAATTGCCGGCAAGGTAGAAAGAACCCTTTATCGCTGCTGCGCTGCTGCGCGAAGATTTAACTACATAACTACACGTATCGATCGCGGAGCGAAAAGTCAACTGGGTCCTGGCGCAGCAACTGCGAAAATCCGCTGCTGGGAATGCCGACCACAGGCACAGTGGATTGAGGAACCTTCTCGACCTGGATCAGTAAGGTCGGCCCATTGCAACAGTG

Full Affymetrix probeset data:

Annotations for 1640532_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720