FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640533_at:

>probe:Drosophila_2:1640533_at:107:559; Interrogation_Position=2244; Antisense; GGAAATCGATCAACTGGTAGCACAA
>probe:Drosophila_2:1640533_at:99:149; Interrogation_Position=2273; Antisense; ACATTTAAGTTCTGGTGCGGCAAAA
>probe:Drosophila_2:1640533_at:324:91; Interrogation_Position=2299; Antisense; AGTTTTGCTTGAATCGAACCGATAC
>probe:Drosophila_2:1640533_at:634:143; Interrogation_Position=2364; Antisense; ACTGCAAATGAAACGCCTAGCTGAT
>probe:Drosophila_2:1640533_at:319:533; Interrogation_Position=2393; Antisense; GGTGAAAGTATCTCTAGTTTAGTTT
>probe:Drosophila_2:1640533_at:642:587; Interrogation_Position=2434; Antisense; TGGTTGTCCCCATTTGTTGGTTTGA
>probe:Drosophila_2:1640533_at:621:445; Interrogation_Position=2457; Antisense; GATGCATTGACGACATGTAACCATA
>probe:Drosophila_2:1640533_at:405:527; Interrogation_Position=2520; Antisense; GGGACTTTTGCCAATTCAATGGTTA
>probe:Drosophila_2:1640533_at:181:61; Interrogation_Position=2538; Antisense; ATGGTTATTCGAACACTTAAGTGAC
>probe:Drosophila_2:1640533_at:37:3; Interrogation_Position=2606; Antisense; ATTGGTCAGTCTTGAATGTTTGGTA
>probe:Drosophila_2:1640533_at:583:539; Interrogation_Position=2627; Antisense; GGTATTCAATTTTCTTTCAGCACTT
>probe:Drosophila_2:1640533_at:77:649; Interrogation_Position=2643; Antisense; TCAGCACTTTCAACTGCAAGCCTAT
>probe:Drosophila_2:1640533_at:163:147; Interrogation_Position=2709; Antisense; ACTCTATGTTAAATGTTGTTGCTGC
>probe:Drosophila_2:1640533_at:50:727; Interrogation_Position=2724; Antisense; TTGTTGCTGCTTCCCACTGTTAAGC

Paste this into a BLAST search page for me
GGAAATCGATCAACTGGTAGCACAAACATTTAAGTTCTGGTGCGGCAAAAAGTTTTGCTTGAATCGAACCGATACACTGCAAATGAAACGCCTAGCTGATGGTGAAAGTATCTCTAGTTTAGTTTTGGTTGTCCCCATTTGTTGGTTTGAGATGCATTGACGACATGTAACCATAGGGACTTTTGCCAATTCAATGGTTAATGGTTATTCGAACACTTAAGTGACATTGGTCAGTCTTGAATGTTTGGTAGGTATTCAATTTTCTTTCAGCACTTTCAGCACTTTCAACTGCAAGCCTATACTCTATGTTAAATGTTGTTGCTGCTTGTTGCTGCTTCCCACTGTTAAGC

Full Affymetrix probeset data:

Annotations for 1640533_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720