FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640536_at:

>probe:Drosophila_2:1640536_at:494:43; Interrogation_Position=551; Antisense; ATCGACGAACGCAAGTGGGTGCTAC
>probe:Drosophila_2:1640536_at:338:293; Interrogation_Position=553; Antisense; CGACGAACGCAAGTGGGTGCTACCG
>probe:Drosophila_2:1640536_at:314:507; Interrogation_Position=569; Antisense; GTGCTACCGGGTAGAGTGGACTACC
>probe:Drosophila_2:1640536_at:113:669; Interrogation_Position=573; Antisense; TACCGGGTAGAGTGGACTACCACAG
>probe:Drosophila_2:1640536_at:316:557; Interrogation_Position=586; Antisense; GGACTACCACAGTGATAGTCTCCAT
>probe:Drosophila_2:1640536_at:62:675; Interrogation_Position=590; Antisense; TACCACAGTGATAGTCTCCATTTTG
>probe:Drosophila_2:1640536_at:643:153; Interrogation_Position=594; Antisense; ACAGTGATAGTCTCCATTTTGAACA
>probe:Drosophila_2:1640536_at:715:457; Interrogation_Position=599; Antisense; GATAGTCTCCATTTTGAACACTCCC
>probe:Drosophila_2:1640536_at:536:673; Interrogation_Position=601; Antisense; TAGTCTCCATTTTGAACACTCCCCA
>probe:Drosophila_2:1640536_at:361:643; Interrogation_Position=604; Antisense; TCTCCATTTTGAACACTCCCCAGAA
>probe:Drosophila_2:1640536_at:502:13; Interrogation_Position=609; Antisense; ATTTTGAACACTCCCCAGAATCTAT
>probe:Drosophila_2:1640536_at:440:723; Interrogation_Position=612; Antisense; TTGAACACTCCCCAGAATCTATGAA
>probe:Drosophila_2:1640536_at:191:387; Interrogation_Position=614; Antisense; GAACACTCCCCAGAATCTATGAAGA
>probe:Drosophila_2:1640536_at:646:257; Interrogation_Position=617; Antisense; CACTCCCCAGAATCTATGAAGAGCT

Paste this into a BLAST search page for me
ATCGACGAACGCAAGTGGGTGCTACCGACGAACGCAAGTGGGTGCTACCGGTGCTACCGGGTAGAGTGGACTACCTACCGGGTAGAGTGGACTACCACAGGGACTACCACAGTGATAGTCTCCATTACCACAGTGATAGTCTCCATTTTGACAGTGATAGTCTCCATTTTGAACAGATAGTCTCCATTTTGAACACTCCCTAGTCTCCATTTTGAACACTCCCCATCTCCATTTTGAACACTCCCCAGAAATTTTGAACACTCCCCAGAATCTATTTGAACACTCCCCAGAATCTATGAAGAACACTCCCCAGAATCTATGAAGACACTCCCCAGAATCTATGAAGAGCT

Full Affymetrix probeset data:

Annotations for 1640536_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720