Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640540_at:

>probe:Drosophila_2:1640540_at:525:93; Interrogation_Position=116; Antisense; AGTTCGGGTGGTTCACCACACGACA
>probe:Drosophila_2:1640540_at:457:631; Interrogation_Position=146; Antisense; TCCGCCCGTGGTGATCATACAACAT
>probe:Drosophila_2:1640540_at:411:33; Interrogation_Position=169; Antisense; ATCAAGCTGTATTGCCGGTGGGTCC
>probe:Drosophila_2:1640540_at:604:7; Interrogation_Position=220; Antisense; ATTGCCATGTCCAGAAACTGACCCG
>probe:Drosophila_2:1640540_at:524:549; Interrogation_Position=248; Antisense; GGAGTACTCGCCCAGTGTGAAAACT
>probe:Drosophila_2:1640540_at:475:511; Interrogation_Position=264; Antisense; GTGAAAACTCACTGCATGGCCGCCA
>probe:Drosophila_2:1640540_at:239:11; Interrogation_Position=288; Antisense; ATTCTATGCATCGTTGGCCTCTGGT
>probe:Drosophila_2:1640540_at:577:381; Interrogation_Position=350; Antisense; GAACGCCAATCACTTTTGCGGCAAT
>probe:Drosophila_2:1640540_at:527:247; Interrogation_Position=372; Antisense; AATTGCAATAAGTTCGTCGGCGTCT
>probe:Drosophila_2:1640540_at:82:501; Interrogation_Position=387; Antisense; GTCGGCGTCTACAACAGCGATTAGT
>probe:Drosophila_2:1640540_at:586:165; Interrogation_Position=446; Antisense; AAATCGAACCGATCAACGCTCACAA
>probe:Drosophila_2:1640540_at:439:81; Interrogation_Position=522; Antisense; AGGTGTCCACAGACCGACAGCTGTA
>probe:Drosophila_2:1640540_at:90:157; Interrogation_Position=538; Antisense; ACAGCTGTACGATGAAATTTCCCCA
>probe:Drosophila_2:1640540_at:283:135; Interrogation_Position=613; Antisense; ACGCGATACGCGAGACACATTTTTT

Paste this into a BLAST search page for me
AGTTCGGGTGGTTCACCACACGACATCCGCCCGTGGTGATCATACAACATATCAAGCTGTATTGCCGGTGGGTCCATTGCCATGTCCAGAAACTGACCCGGGAGTACTCGCCCAGTGTGAAAACTGTGAAAACTCACTGCATGGCCGCCAATTCTATGCATCGTTGGCCTCTGGTGAACGCCAATCACTTTTGCGGCAATAATTGCAATAAGTTCGTCGGCGTCTGTCGGCGTCTACAACAGCGATTAGTAAATCGAACCGATCAACGCTCACAAAGGTGTCCACAGACCGACAGCTGTAACAGCTGTACGATGAAATTTCCCCAACGCGATACGCGAGACACATTTTTT

Full Affymetrix probeset data:

Annotations for 1640540_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime