FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640541_at:

>probe:Drosophila_2:1640541_at:472:375; Interrogation_Position=8613; Antisense; GAAGAGGACGCAACTACTGCTACCA
>probe:Drosophila_2:1640541_at:649:155; Interrogation_Position=8637; Antisense; ACAGCGGCCACCACAGAGGTCACAA
>probe:Drosophila_2:1640541_at:628:435; Interrogation_Position=8652; Antisense; GAGGTCACAACATCGCCAGCGACAG
>probe:Drosophila_2:1640541_at:353:123; Interrogation_Position=8669; Antisense; AGCGACAGCTATCGCAACGGCAGCA
>probe:Drosophila_2:1640541_at:129:263; Interrogation_Position=8689; Antisense; CAGCAACTTTAGAGCCTGCCGGAAT
>probe:Drosophila_2:1640541_at:15:125; Interrogation_Position=8701; Antisense; AGCCTGCCGGAATGAGTGAGCTCAC
>probe:Drosophila_2:1640541_at:535:79; Interrogation_Position=8715; Antisense; AGTGAGCTCACGACGATGGTAGAGA
>probe:Drosophila_2:1640541_at:67:231; Interrogation_Position=8793; Antisense; AATGTATTCGCAACCTAGCTGGAGG
>probe:Drosophila_2:1640541_at:86:709; Interrogation_Position=8842; Antisense; TTAAATGTAACCAAAGCAGCCTGAC
>probe:Drosophila_2:1640541_at:378:209; Interrogation_Position=8855; Antisense; AAGCAGCCTGACAATGAGAACGGTG
>probe:Drosophila_2:1640541_at:647:197; Interrogation_Position=8873; Antisense; AACGGTGTGGACAGGTGTTTACTAG
>probe:Drosophila_2:1640541_at:620:449; Interrogation_Position=8902; Antisense; GATCCCCACCGTCGAAAACGAGACT
>probe:Drosophila_2:1640541_at:379:667; Interrogation_Position=8978; Antisense; TACTTGGTTGGAGCGATGCGAGTCA
>probe:Drosophila_2:1640541_at:90:357; Interrogation_Position=9040; Antisense; GCAAAGGTGTTTATTAGCTATCGAA

Paste this into a BLAST search page for me
GAAGAGGACGCAACTACTGCTACCAACAGCGGCCACCACAGAGGTCACAAGAGGTCACAACATCGCCAGCGACAGAGCGACAGCTATCGCAACGGCAGCACAGCAACTTTAGAGCCTGCCGGAATAGCCTGCCGGAATGAGTGAGCTCACAGTGAGCTCACGACGATGGTAGAGAAATGTATTCGCAACCTAGCTGGAGGTTAAATGTAACCAAAGCAGCCTGACAAGCAGCCTGACAATGAGAACGGTGAACGGTGTGGACAGGTGTTTACTAGGATCCCCACCGTCGAAAACGAGACTTACTTGGTTGGAGCGATGCGAGTCAGCAAAGGTGTTTATTAGCTATCGAA

Full Affymetrix probeset data:

Annotations for 1640541_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720