Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640542_at:

>probe:Drosophila_2:1640542_at:495:45; Interrogation_Position=1735; Antisense; ATCGCCTGGCCGTTGGGTCTGAGTT
>probe:Drosophila_2:1640542_at:682:455; Interrogation_Position=1784; Antisense; GATATGGTGGACTGGCCAACTCGTT
>probe:Drosophila_2:1640542_at:2:471; Interrogation_Position=1806; Antisense; GTTCCTTACATCACCATTGTGGCAG
>probe:Drosophila_2:1640542_at:303:279; Interrogation_Position=1857; Antisense; CTACATGGGCCATCTGTTTATTCAG
>probe:Drosophila_2:1640542_at:321:263; Interrogation_Position=1879; Antisense; CAGAACCTTAATGCTGGGCGCACGA
>probe:Drosophila_2:1640542_at:22:435; Interrogation_Position=1902; Antisense; GAGGGTGAACACCTACTTCTCAAAC
>probe:Drosophila_2:1640542_at:685:689; Interrogation_Position=1946; Antisense; TTTGGCAAGACTTCGGGTTCACGGT
>probe:Drosophila_2:1640542_at:98:505; Interrogation_Position=1969; Antisense; GTCCTACTCGCTTATGTCATGTACA
>probe:Drosophila_2:1640542_at:136:489; Interrogation_Position=1989; Antisense; GTACATTTTGATCGAAGCTCCTTGC
>probe:Drosophila_2:1640542_at:518:587; Interrogation_Position=2021; Antisense; TGGAGAGTCTGATCCTGCCGAACCG
>probe:Drosophila_2:1640542_at:34:81; Interrogation_Position=2066; Antisense; AGGTGCAGGCTGCTGAACCATCTAA
>probe:Drosophila_2:1640542_at:350:83; Interrogation_Position=2091; Antisense; AGAGGAAATCCCATCACCTGTTGAC
>probe:Drosophila_2:1640542_at:293:433; Interrogation_Position=2139; Antisense; GAGTGCTGCCATCGATCTTGCAAAT
>probe:Drosophila_2:1640542_at:385:729; Interrogation_Position=2173; Antisense; TTGGCAACAGCTCCTCCATTAGAAG

Paste this into a BLAST search page for me
ATCGCCTGGCCGTTGGGTCTGAGTTGATATGGTGGACTGGCCAACTCGTTGTTCCTTACATCACCATTGTGGCAGCTACATGGGCCATCTGTTTATTCAGCAGAACCTTAATGCTGGGCGCACGAGAGGGTGAACACCTACTTCTCAAACTTTGGCAAGACTTCGGGTTCACGGTGTCCTACTCGCTTATGTCATGTACAGTACATTTTGATCGAAGCTCCTTGCTGGAGAGTCTGATCCTGCCGAACCGAGGTGCAGGCTGCTGAACCATCTAAAGAGGAAATCCCATCACCTGTTGACGAGTGCTGCCATCGATCTTGCAAATTTGGCAACAGCTCCTCCATTAGAAG

Full Affymetrix probeset data:

Annotations for 1640542_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime