FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640543_at:

>probe:Drosophila_2:1640543_at:11:99; Interrogation_Position=136; Antisense; AGATCCGCAGATCAGTGCACTCCTG
>probe:Drosophila_2:1640543_at:497:145; Interrogation_Position=154; Antisense; ACTCCTGGCACGATACTTAAGCTGA
>probe:Drosophila_2:1640543_at:114:585; Interrogation_Position=182; Antisense; TGGACAATTTCTTCGAAACCACCGA
>probe:Drosophila_2:1640543_at:164:329; Interrogation_Position=208; Antisense; GATGGGACGTTCTTCGTAAAGTTCT
>probe:Drosophila_2:1640543_at:47:65; Interrogation_Position=247; Antisense; ATGGGCTGCCACGATTTCGAAACTA
>probe:Drosophila_2:1640543_at:216:389; Interrogation_Position=265; Antisense; GAAACTACCTGGACTGACATGGCCA
>probe:Drosophila_2:1640543_at:220:399; Interrogation_Position=280; Antisense; GACATGGCCAAATCGTTCAAGTCGA
>probe:Drosophila_2:1640543_at:640:181; Interrogation_Position=308; Antisense; AAAACATTTGTTTTGCTGAGCTCAA
>probe:Drosophila_2:1640543_at:365:403; Interrogation_Position=361; Antisense; GACTATGAGCTTCGGTATGAACCAA
>probe:Drosophila_2:1640543_at:599:149; Interrogation_Position=434; Antisense; ACTTGACTTCCCCTGGCATTAAAAT
>probe:Drosophila_2:1640543_at:470:369; Interrogation_Position=483; Antisense; GAATGAAACCAACAAATCCGCCGCC
>probe:Drosophila_2:1640543_at:442:579; Interrogation_Position=512; Antisense; GGCCATATTTTCACACCAAGCCAAT
>probe:Drosophila_2:1640543_at:710:683; Interrogation_Position=537; Antisense; TATCCTCTTTGGATGGTTCCTCTAT
>probe:Drosophila_2:1640543_at:322:165; Interrogation_Position=76; Antisense; AAATCTCTATCGAAACAGTCCGGAA

Paste this into a BLAST search page for me
AGATCCGCAGATCAGTGCACTCCTGACTCCTGGCACGATACTTAAGCTGATGGACAATTTCTTCGAAACCACCGAGATGGGACGTTCTTCGTAAAGTTCTATGGGCTGCCACGATTTCGAAACTAGAAACTACCTGGACTGACATGGCCAGACATGGCCAAATCGTTCAAGTCGAAAAACATTTGTTTTGCTGAGCTCAAGACTATGAGCTTCGGTATGAACCAAACTTGACTTCCCCTGGCATTAAAATGAATGAAACCAACAAATCCGCCGCCGGCCATATTTTCACACCAAGCCAATTATCCTCTTTGGATGGTTCCTCTATAAATCTCTATCGAAACAGTCCGGAA

Full Affymetrix probeset data:

Annotations for 1640543_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720