Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640544_a_at:

>probe:Drosophila_2:1640544_a_at:621:437; Interrogation_Position=138; Antisense; GAGGCAATTCCTGAACACGCTGGTC
>probe:Drosophila_2:1640544_a_at:11:385; Interrogation_Position=150; Antisense; GAACACGCTGGTCAAGCTTTGTAAA
>probe:Drosophila_2:1640544_a_at:88:467; Interrogation_Position=196; Antisense; GTAAATCCCAAACAAACCATCAGTA
>probe:Drosophila_2:1640544_a_at:260:257; Interrogation_Position=216; Antisense; CAGTAATATTAACACGATCACGAAC
>probe:Drosophila_2:1640544_a_at:201:385; Interrogation_Position=237; Antisense; GAACAACATCAGCATGCCGGAAATT
>probe:Drosophila_2:1640544_a_at:651:557; Interrogation_Position=255; Antisense; GGAAATTCAATTGCCACCGATTACG
>probe:Drosophila_2:1640544_a_at:282:261; Interrogation_Position=269; Antisense; CACCGATTACGGTTGTCATCGTGAA
>probe:Drosophila_2:1640544_a_at:721:223; Interrogation_Position=301; Antisense; AAGGAGCTGGCCAAATACCAAGAGA
>probe:Drosophila_2:1640544_a_at:706:519; Interrogation_Position=338; Antisense; GGGCCATAATAATCAAACGTCGTAG
>probe:Drosophila_2:1640544_a_at:302:539; Interrogation_Position=34; Antisense; GGTAACAACGATGATAGCTCTGCAC
>probe:Drosophila_2:1640544_a_at:708:197; Interrogation_Position=353; Antisense; AACGTCGTAGCAACGCCAAGGAGGA
>probe:Drosophila_2:1640544_a_at:583:223; Interrogation_Position=370; Antisense; AAGGAGGATACCAAACCTGCACCCA
>probe:Drosophila_2:1640544_a_at:313:603; Interrogation_Position=45; Antisense; TGATAGCTCTGCACCGGAACCGGAA
>probe:Drosophila_2:1640544_a_at:42:35; Interrogation_Position=78; Antisense; ATCACACGCGAAACCCAATACATAT

Paste this into a BLAST search page for me
GAGGCAATTCCTGAACACGCTGGTCGAACACGCTGGTCAAGCTTTGTAAAGTAAATCCCAAACAAACCATCAGTACAGTAATATTAACACGATCACGAACGAACAACATCAGCATGCCGGAAATTGGAAATTCAATTGCCACCGATTACGCACCGATTACGGTTGTCATCGTGAAAAGGAGCTGGCCAAATACCAAGAGAGGGCCATAATAATCAAACGTCGTAGGGTAACAACGATGATAGCTCTGCACAACGTCGTAGCAACGCCAAGGAGGAAAGGAGGATACCAAACCTGCACCCATGATAGCTCTGCACCGGAACCGGAAATCACACGCGAAACCCAATACATAT

Full Affymetrix probeset data:

Annotations for 1640544_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime