FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640547_at:

>probe:Drosophila_2:1640547_at:152:381; Interrogation_Position=4436; Antisense; GAACCTACTTTATATCTAGCTGATG
>probe:Drosophila_2:1640547_at:286:279; Interrogation_Position=4451; Antisense; CTAGCTGATGTCAGTACTGAGCTTA
>probe:Drosophila_2:1640547_at:221:697; Interrogation_Position=4486; Antisense; TTTAGCTAAGCCCAAAACGTTGATA
>probe:Drosophila_2:1640547_at:507:197; Interrogation_Position=4547; Antisense; AAGCCTTACAGGCTAAGTTGTAGGG
>probe:Drosophila_2:1640547_at:281:365; Interrogation_Position=4596; Antisense; GAATATATACTTAACCACTGCCAAC
>probe:Drosophila_2:1640547_at:684:181; Interrogation_Position=4629; Antisense; AAAAGTGCCTCGAAATCGAATCGAA
>probe:Drosophila_2:1640547_at:660:635; Interrogation_Position=4644; Antisense; TCGAATCGAAAGTCCAATTTACCGG
>probe:Drosophila_2:1640547_at:694:695; Interrogation_Position=4661; Antisense; TTTACCGGACACGAGTTAGGATCAA
>probe:Drosophila_2:1640547_at:239:481; Interrogation_Position=4722; Antisense; GTATTAGCACTAACTTAATGCATTA
>probe:Drosophila_2:1640547_at:221:33; Interrogation_Position=4753; Antisense; ATAATCCACGCAACTAAATTTAGCA
>probe:Drosophila_2:1640547_at:62:699; Interrogation_Position=4771; Antisense; TTTAGCACACACCAGCAAGAATATT
>probe:Drosophila_2:1640547_at:97:17; Interrogation_Position=4799; Antisense; ATTTTGTTTGTTTTCCGTCAGCTAT
>probe:Drosophila_2:1640547_at:119:539; Interrogation_Position=4807; Antisense; TGTTTTCCGTCAGCTATTCTAAGTG
>probe:Drosophila_2:1640547_at:121:461; Interrogation_Position=4972; Antisense; GATTTATTCAATATACACTTCCTTT

Paste this into a BLAST search page for me
GAACCTACTTTATATCTAGCTGATGCTAGCTGATGTCAGTACTGAGCTTATTTAGCTAAGCCCAAAACGTTGATAAAGCCTTACAGGCTAAGTTGTAGGGGAATATATACTTAACCACTGCCAACAAAAGTGCCTCGAAATCGAATCGAATCGAATCGAAAGTCCAATTTACCGGTTTACCGGACACGAGTTAGGATCAAGTATTAGCACTAACTTAATGCATTAATAATCCACGCAACTAAATTTAGCATTTAGCACACACCAGCAAGAATATTATTTTGTTTGTTTTCCGTCAGCTATTGTTTTCCGTCAGCTATTCTAAGTGGATTTATTCAATATACACTTCCTTT

Full Affymetrix probeset data:

Annotations for 1640547_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720