FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640549_at:

>probe:Drosophila_2:1640549_at:640:657; Interrogation_Position=1019; Antisense; TAAGTAGATGTTCCTCTGGGTCCGC
>probe:Drosophila_2:1640549_at:245:47; Interrogation_Position=606; Antisense; ATCCTGGACTGGTACGTGGCCAACA
>probe:Drosophila_2:1640549_at:386:225; Interrogation_Position=657; Antisense; AAGGACCCGGGCGTGATCTCCGTGA
>probe:Drosophila_2:1640549_at:121:37; Interrogation_Position=672; Antisense; ATCTCCGTGACGAACATCTACAACT
>probe:Drosophila_2:1640549_at:73:109; Interrogation_Position=703; Antisense; AGAAGTTCGGCTACAAGACCCTGGT
>probe:Drosophila_2:1640549_at:1:629; Interrogation_Position=738; Antisense; TCCTTCCGTAACGTGGGCGAAATCA
>probe:Drosophila_2:1640549_at:145:287; Interrogation_Position=772; Antisense; CTGGCTGCGATCTGCTTACCATCAG
>probe:Drosophila_2:1640549_at:107:35; Interrogation_Position=792; Antisense; ATCAGCCCAGCGCTGCTTAAGGAGC
>probe:Drosophila_2:1640549_at:256:135; Interrogation_Position=823; Antisense; ACGAGACCGAGTCGGTGGTCACCTA
>probe:Drosophila_2:1640549_at:716:589; Interrogation_Position=838; Antisense; TGGTCACCTACCTGTCCGTAAGCAA
>probe:Drosophila_2:1640549_at:297:497; Interrogation_Position=851; Antisense; GTCCGTAAGCAACGCCAAGCTGCAG
>probe:Drosophila_2:1640549_at:603:109; Interrogation_Position=883; Antisense; AGAAGATCACCGTCGATGAGAGCCG
>probe:Drosophila_2:1640549_at:239:131; Interrogation_Position=942; Antisense; ACCGACAAACTTTCCGAGGGCATCA
>probe:Drosophila_2:1640549_at:722:213; Interrogation_Position=969; Antisense; AAGTTCGCCGTGGATACTGTTAAGC

Paste this into a BLAST search page for me
TAAGTAGATGTTCCTCTGGGTCCGCATCCTGGACTGGTACGTGGCCAACAAAGGACCCGGGCGTGATCTCCGTGAATCTCCGTGACGAACATCTACAACTAGAAGTTCGGCTACAAGACCCTGGTTCCTTCCGTAACGTGGGCGAAATCACTGGCTGCGATCTGCTTACCATCAGATCAGCCCAGCGCTGCTTAAGGAGCACGAGACCGAGTCGGTGGTCACCTATGGTCACCTACCTGTCCGTAAGCAAGTCCGTAAGCAACGCCAAGCTGCAGAGAAGATCACCGTCGATGAGAGCCGACCGACAAACTTTCCGAGGGCATCAAAGTTCGCCGTGGATACTGTTAAGC

Full Affymetrix probeset data:

Annotations for 1640549_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720