Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640551_at:

>probe:Drosophila_2:1640551_at:512:149; Interrogation_Position=1771; Antisense; ACTTCAACGCCAGTTTCTGTTGTTA
>probe:Drosophila_2:1640551_at:140:315; Interrogation_Position=1821; Antisense; GCCATATCATTGGTCAACTCATTAT
>probe:Drosophila_2:1640551_at:257:171; Interrogation_Position=1858; Antisense; AAAGTGTTTCCTCAGTATTGATAAG
>probe:Drosophila_2:1640551_at:317:419; Interrogation_Position=1905; Antisense; GAGCACGACAATTGAATCTGTTTTT
>probe:Drosophila_2:1640551_at:399:5; Interrogation_Position=1938; Antisense; ATTGCAGTGGACTTATCACCAATTA
>probe:Drosophila_2:1640551_at:381:111; Interrogation_Position=1980; Antisense; AGAATCATATCCGAATGCCTCCAGT
>probe:Drosophila_2:1640551_at:534:367; Interrogation_Position=1992; Antisense; GAATGCCTCCAGTGCTTGTGGAACC
>probe:Drosophila_2:1640551_at:32:561; Interrogation_Position=2011; Antisense; GGAACCCATGACCTCCTTAGGAAAT
>probe:Drosophila_2:1640551_at:507:509; Interrogation_Position=2037; Antisense; GTGCATTGCCGCACAGAGCAACTGG
>probe:Drosophila_2:1640551_at:517:419; Interrogation_Position=2052; Antisense; GAGCAACTGGCCTTCGGACCTTGGA
>probe:Drosophila_2:1640551_at:431:555; Interrogation_Position=2067; Antisense; GGACCTTGGAGCATACTGCTCGATA
>probe:Drosophila_2:1640551_at:158:669; Interrogation_Position=2080; Antisense; TACTGCTCGATATCATGCACGTAAT
>probe:Drosophila_2:1640551_at:417:349; Interrogation_Position=2096; Antisense; GCACGTAATTTCATATCTTCGATAG
>probe:Drosophila_2:1640551_at:660:383; Interrogation_Position=2246; Antisense; GTAAAGTTCCAGAGGCAAAACCAGA

Paste this into a BLAST search page for me
ACTTCAACGCCAGTTTCTGTTGTTAGCCATATCATTGGTCAACTCATTATAAAGTGTTTCCTCAGTATTGATAAGGAGCACGACAATTGAATCTGTTTTTATTGCAGTGGACTTATCACCAATTAAGAATCATATCCGAATGCCTCCAGTGAATGCCTCCAGTGCTTGTGGAACCGGAACCCATGACCTCCTTAGGAAATGTGCATTGCCGCACAGAGCAACTGGGAGCAACTGGCCTTCGGACCTTGGAGGACCTTGGAGCATACTGCTCGATATACTGCTCGATATCATGCACGTAATGCACGTAATTTCATATCTTCGATAGGTAAAGTTCCAGAGGCAAAACCAGA

Full Affymetrix probeset data:

Annotations for 1640551_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime