FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640552_at:

>probe:Drosophila_2:1640552_at:66:329; Interrogation_Position=1027; Antisense; GCGTCGAGGTCGAGCGTTTAGTTTT
>probe:Drosophila_2:1640552_at:557:491; Interrogation_Position=1054; Antisense; GTAACTCCCACATACAGATGCTAGG
>probe:Drosophila_2:1640552_at:478:379; Interrogation_Position=1160; Antisense; GAAGCCGATCGATTCACTTTGCTGT
>probe:Drosophila_2:1640552_at:558:569; Interrogation_Position=1245; Antisense; GGCTATTGTGTGTCACTGGCTTCCA
>probe:Drosophila_2:1640552_at:632:17; Interrogation_Position=1288; Antisense; ATTTGAGCCCCAACCGGTTTGAATG
>probe:Drosophila_2:1640552_at:171:367; Interrogation_Position=1308; Antisense; GAATGCCTCGGCTACAAATTAAGTG
>probe:Drosophila_2:1640552_at:455:245; Interrogation_Position=1324; Antisense; AATTAAGTGTACGTCCAGCTGGTGT
>probe:Drosophila_2:1640552_at:167:531; Interrogation_Position=1344; Antisense; GGTGTAATTTATATGCTCTGGTCGC
>probe:Drosophila_2:1640552_at:524:407; Interrogation_Position=1370; Antisense; GACGAGTACTCTTGGTGATTTCCTT
>probe:Drosophila_2:1640552_at:460:513; Interrogation_Position=1384; Antisense; GTGATTTCCTTGTTGTGGCTTGTTA
>probe:Drosophila_2:1640552_at:442:581; Interrogation_Position=1399; Antisense; TGGCTTGTTATTTGCCCCAACTAAT
>probe:Drosophila_2:1640552_at:12:411; Interrogation_Position=1489; Antisense; GACCCATCTAGATCACGTGGCTGAC
>probe:Drosophila_2:1640552_at:41:583; Interrogation_Position=942; Antisense; TGGCTACACAATCGACTGGACACTG
>probe:Drosophila_2:1640552_at:42:587; Interrogation_Position=958; Antisense; TGGACACTGCGTTACCAGGTGCATG

Paste this into a BLAST search page for me
GCGTCGAGGTCGAGCGTTTAGTTTTGTAACTCCCACATACAGATGCTAGGGAAGCCGATCGATTCACTTTGCTGTGGCTATTGTGTGTCACTGGCTTCCAATTTGAGCCCCAACCGGTTTGAATGGAATGCCTCGGCTACAAATTAAGTGAATTAAGTGTACGTCCAGCTGGTGTGGTGTAATTTATATGCTCTGGTCGCGACGAGTACTCTTGGTGATTTCCTTGTGATTTCCTTGTTGTGGCTTGTTATGGCTTGTTATTTGCCCCAACTAATGACCCATCTAGATCACGTGGCTGACTGGCTACACAATCGACTGGACACTGTGGACACTGCGTTACCAGGTGCATG

Full Affymetrix probeset data:

Annotations for 1640552_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720