FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640553_at:

>probe:Drosophila_2:1640553_at:413:263; Interrogation_Position=104; Antisense; CAGCTGCCACAACCGTTGTCCAGGA
>probe:Drosophila_2:1640553_at:102:599; Interrogation_Position=120; Antisense; TGTCCAGGAGCGCTCTCTGGCCAAG
>probe:Drosophila_2:1640553_at:134:591; Interrogation_Position=155; Antisense; TGGTCAGCAGCATTCCCACATCGGT
>probe:Drosophila_2:1640553_at:115:163; Interrogation_Position=19; Antisense; AAATTGGTGGTGTTGTCTGCTCTCC
>probe:Drosophila_2:1640553_at:727:591; Interrogation_Position=200; Antisense; TGGTGCACAGCCACTCGCATGTAGT
>probe:Drosophila_2:1640553_at:602:57; Interrogation_Position=218; Antisense; ATGTAGTGGAGGACATCGTGGCCCC
>probe:Drosophila_2:1640553_at:526:41; Interrogation_Position=232; Antisense; ATCGTGGCCCCGGTGGTGAAGTCCA
>probe:Drosophila_2:1640553_at:26:285; Interrogation_Position=275; Antisense; CTGCAGCTGCCCCAGTGGTGCATAC
>probe:Drosophila_2:1640553_at:602:267; Interrogation_Position=287; Antisense; CAGTGGTGCATACCGCCTATGCTGC
>probe:Drosophila_2:1640553_at:535:47; Interrogation_Position=362; Antisense; ATGCCGCCGCTTCTCCGGTTGTCTA
>probe:Drosophila_2:1640553_at:458:541; Interrogation_Position=378; Antisense; GGTTGTCTACAACTCCAGCTGGTAA
>probe:Drosophila_2:1640553_at:306:639; Interrogation_Position=60; Antisense; TCGTCCCGGTCATCTTTATGAGTCT
>probe:Drosophila_2:1640553_at:308:705; Interrogation_Position=75; Antisense; TTATGAGTCTCCTCTGGTTTATGCC
>probe:Drosophila_2:1640553_at:571:477; Interrogation_Position=91; Antisense; GTTTATGCCGCTCCAGCTGCCACAA

Paste this into a BLAST search page for me
CAGCTGCCACAACCGTTGTCCAGGATGTCCAGGAGCGCTCTCTGGCCAAGTGGTCAGCAGCATTCCCACATCGGTAAATTGGTGGTGTTGTCTGCTCTCCTGGTGCACAGCCACTCGCATGTAGTATGTAGTGGAGGACATCGTGGCCCCATCGTGGCCCCGGTGGTGAAGTCCACTGCAGCTGCCCCAGTGGTGCATACCAGTGGTGCATACCGCCTATGCTGCATGCCGCCGCTTCTCCGGTTGTCTAGGTTGTCTACAACTCCAGCTGGTAATCGTCCCGGTCATCTTTATGAGTCTTTATGAGTCTCCTCTGGTTTATGCCGTTTATGCCGCTCCAGCTGCCACAA

Full Affymetrix probeset data:

Annotations for 1640553_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720