Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640554_at:

>probe:Drosophila_2:1640554_at:243:437; Interrogation_Position=1366; Antisense; GAGGCTCAAGAATTCGATTACGGAC
>probe:Drosophila_2:1640554_at:281:557; Interrogation_Position=1387; Antisense; GGACATGGACAGTATCGCGGTAACA
>probe:Drosophila_2:1640554_at:200:235; Interrogation_Position=1411; Antisense; AATCCGCAGATTCAGTTCTCCGTGT
>probe:Drosophila_2:1640554_at:170:119; Interrogation_Position=1451; Antisense; AGCTCCTGTGGCTCGATGGGATGAA
>probe:Drosophila_2:1640554_at:194:445; Interrogation_Position=1470; Antisense; GATGAAGTTCTTCCGCAACAACATA
>probe:Drosophila_2:1640554_at:725:259; Interrogation_Position=1500; Antisense; CACGAATTTGTACTGGCGCTGCCAT
>probe:Drosophila_2:1640554_at:672:323; Interrogation_Position=1515; Antisense; GCGCTGCCATTGGTATTATCGGCAT
>probe:Drosophila_2:1640554_at:429:27; Interrogation_Position=1538; Antisense; ATACCAAGTGCCCAGTGCTAATTTG
>probe:Drosophila_2:1640554_at:460:163; Interrogation_Position=1575; Antisense; AAATAGCAACGACTTCCGGCAGATC
>probe:Drosophila_2:1640554_at:559:385; Interrogation_Position=1633; Antisense; GAAAACTCTGGCACGGGAGACGGTC
>probe:Drosophila_2:1640554_at:50:657; Interrogation_Position=1664; Antisense; TAAGGACTCCTGTGGTGTCCAACGT
>probe:Drosophila_2:1640554_at:634:531; Interrogation_Position=1677; Antisense; GGTGTCCAACGTGAGGAGTCTTCCT
>probe:Drosophila_2:1640554_at:700:549; Interrogation_Position=1691; Antisense; GGAGTCTTCCTCAGAGCATGGCGCA
>probe:Drosophila_2:1640554_at:542:269; Interrogation_Position=1707; Antisense; CATGGCGCACATGTTCGATATGTAA

Paste this into a BLAST search page for me
GAGGCTCAAGAATTCGATTACGGACGGACATGGACAGTATCGCGGTAACAAATCCGCAGATTCAGTTCTCCGTGTAGCTCCTGTGGCTCGATGGGATGAAGATGAAGTTCTTCCGCAACAACATACACGAATTTGTACTGGCGCTGCCATGCGCTGCCATTGGTATTATCGGCATATACCAAGTGCCCAGTGCTAATTTGAAATAGCAACGACTTCCGGCAGATCGAAAACTCTGGCACGGGAGACGGTCTAAGGACTCCTGTGGTGTCCAACGTGGTGTCCAACGTGAGGAGTCTTCCTGGAGTCTTCCTCAGAGCATGGCGCACATGGCGCACATGTTCGATATGTAA

Full Affymetrix probeset data:

Annotations for 1640554_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime