FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640557_at:

>probe:Drosophila_2:1640557_at:688:197; Interrogation_Position=2906; Antisense; AACGATTTTGTTTGTTGAGCCCATC
>probe:Drosophila_2:1640557_at:100:469; Interrogation_Position=2919; Antisense; GTTGAGCCCATCTCGCAAGGATATT
>probe:Drosophila_2:1640557_at:565:457; Interrogation_Position=2938; Antisense; GATATTGAGCACTTGTCGCAGTCGT
>probe:Drosophila_2:1640557_at:588:501; Interrogation_Position=2952; Antisense; GTCGCAGTCGTCGTTTTCTTTTGGT
>probe:Drosophila_2:1640557_at:4:243; Interrogation_Position=3006; Antisense; AATAGCCTACACGTACATGCCTAAA
>probe:Drosophila_2:1640557_at:486:489; Interrogation_Position=3018; Antisense; GTACATGCCTAAATCGCGCGCAATA
>probe:Drosophila_2:1640557_at:257:323; Interrogation_Position=3033; Antisense; GCGCGCAATACGTGAATTTCTTTAA
>probe:Drosophila_2:1640557_at:167:207; Interrogation_Position=3071; Antisense; AAGCTGCAAGCTACCCAATTTTTGT
>probe:Drosophila_2:1640557_at:477:323; Interrogation_Position=3104; Antisense; GCGAAAGTACGATCCCGAGAATCCT
>probe:Drosophila_2:1640557_at:582:37; Interrogation_Position=3139; Antisense; ATCTTCCTGTATGCGCCTTTAAATT
>probe:Drosophila_2:1640557_at:458:95; Interrogation_Position=3197; Antisense; AGATATTTCTGCTCTTCTTTTTAAA
>probe:Drosophila_2:1640557_at:247:661; Interrogation_Position=3336; Antisense; TAAAACCATTTGATTTTGCTACTTA
>probe:Drosophila_2:1640557_at:684:325; Interrogation_Position=3405; Antisense; GCGAGTTGAACACGAAATCCCATAT
>probe:Drosophila_2:1640557_at:221:29; Interrogation_Position=3438; Antisense; ATAAAATGCCTTTTGCTACCGAGCA

Paste this into a BLAST search page for me
AACGATTTTGTTTGTTGAGCCCATCGTTGAGCCCATCTCGCAAGGATATTGATATTGAGCACTTGTCGCAGTCGTGTCGCAGTCGTCGTTTTCTTTTGGTAATAGCCTACACGTACATGCCTAAAGTACATGCCTAAATCGCGCGCAATAGCGCGCAATACGTGAATTTCTTTAAAAGCTGCAAGCTACCCAATTTTTGTGCGAAAGTACGATCCCGAGAATCCTATCTTCCTGTATGCGCCTTTAAATTAGATATTTCTGCTCTTCTTTTTAAATAAAACCATTTGATTTTGCTACTTAGCGAGTTGAACACGAAATCCCATATATAAAATGCCTTTTGCTACCGAGCA

Full Affymetrix probeset data:

Annotations for 1640557_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720