Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640559_at:

>probe:Drosophila_2:1640559_at:651:471; Interrogation_Position=1464; Antisense; GTTCAGCATATTTGATCCACTTCGG
>probe:Drosophila_2:1640559_at:610:395; Interrogation_Position=1549; Antisense; GAAATAGCCAGCAAGCCCGCCGATT
>probe:Drosophila_2:1640559_at:603:571; Interrogation_Position=1578; Antisense; GGCTCCATATCTGGTGCCCTATAAA
>probe:Drosophila_2:1640559_at:355:547; Interrogation_Position=1608; Antisense; GGAGGAACTTACTCCCGAGCAATCT
>probe:Drosophila_2:1640559_at:210:661; Interrogation_Position=1644; Antisense; TAACGCCTGTCTAAACGATCTGAAG
>probe:Drosophila_2:1640559_at:138:219; Interrogation_Position=1666; Antisense; AAGTCTCGGTTTGTGAGTCTGCTCA
>probe:Drosophila_2:1640559_at:420:339; Interrogation_Position=1686; Antisense; GCTCAACAACTTGCAACGTCACTAT
>probe:Drosophila_2:1640559_at:419:707; Interrogation_Position=1717; Antisense; TTAACCTCCGAGTCAAAGTCGCTGA
>probe:Drosophila_2:1640559_at:416:219; Interrogation_Position=1732; Antisense; AAGTCGCTGAATCGATTCCTAAACA
>probe:Drosophila_2:1640559_at:100:467; Interrogation_Position=1794; Antisense; GTTGGTGCAACAATCGAAGGATCTC
>probe:Drosophila_2:1640559_at:683:323; Interrogation_Position=1830; Antisense; GCGAATGGTGCAACAGCGTCTGACT
>probe:Drosophila_2:1640559_at:48:329; Interrogation_Position=1845; Antisense; GCGTCTGACTCTGACCCATGAGGAG
>probe:Drosophila_2:1640559_at:395:373; Interrogation_Position=1885; Antisense; GAAGTGGTCAAGAACTCCCTGCTCA
>probe:Drosophila_2:1640559_at:469:283; Interrogation_Position=1903; Antisense; CTGCTCAAGGATCCACGACTGAATT

Paste this into a BLAST search page for me
GTTCAGCATATTTGATCCACTTCGGGAAATAGCCAGCAAGCCCGCCGATTGGCTCCATATCTGGTGCCCTATAAAGGAGGAACTTACTCCCGAGCAATCTTAACGCCTGTCTAAACGATCTGAAGAAGTCTCGGTTTGTGAGTCTGCTCAGCTCAACAACTTGCAACGTCACTATTTAACCTCCGAGTCAAAGTCGCTGAAAGTCGCTGAATCGATTCCTAAACAGTTGGTGCAACAATCGAAGGATCTCGCGAATGGTGCAACAGCGTCTGACTGCGTCTGACTCTGACCCATGAGGAGGAAGTGGTCAAGAACTCCCTGCTCACTGCTCAAGGATCCACGACTGAATT

Full Affymetrix probeset data:

Annotations for 1640559_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime