Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640560_at:

>probe:Drosophila_2:1640560_at:146:71; Interrogation_Position=1014; Antisense; AGGCGTCCGCCAAGATGTTCATCAA
>probe:Drosophila_2:1640560_at:652:471; Interrogation_Position=1030; Antisense; GTTCATCAATTATGCCTTCACTGTG
>probe:Drosophila_2:1640560_at:173:133; Interrogation_Position=1074; Antisense; ACCGCTTCTCGGTGGACACATTGGA
>probe:Drosophila_2:1640560_at:543:657; Interrogation_Position=1158; Antisense; TAAGTCTTTCTAAGTGCTGTGCACA
>probe:Drosophila_2:1640560_at:103:3; Interrogation_Position=662; Antisense; ATTGTCTTTGGGTGCATCTTCGAGA
>probe:Drosophila_2:1640560_at:378:135; Interrogation_Position=692; Antisense; ACGCTGCTGGTGGTATGTCTGCACA
>probe:Drosophila_2:1640560_at:710:659; Interrogation_Position=732; Antisense; TAACGTGGCCGTTTGTGCTAATTGG
>probe:Drosophila_2:1640560_at:203:345; Interrogation_Position=756; Antisense; GCATTGGCGTGCTGGTTGTCTATAC
>probe:Drosophila_2:1640560_at:256:543; Interrogation_Position=825; Antisense; GGATCCTAATCCTGGCAAGCATTGT
>probe:Drosophila_2:1640560_at:471:207; Interrogation_Position=841; Antisense; AAGCATTGTGGTCTTCCTGGTCTCG
>probe:Drosophila_2:1640560_at:15:99; Interrogation_Position=891; Antisense; AGATGCGATACTACGTGCCCGCTAG
>probe:Drosophila_2:1640560_at:475:675; Interrogation_Position=913; Antisense; TAGCGTCTGTTTGGTTTTCTTCGGA
>probe:Drosophila_2:1640560_at:421:109; Interrogation_Position=960; Antisense; AGAAGTTGTTCCTGCACCACAAGCG
>probe:Drosophila_2:1640560_at:133:207; Interrogation_Position=980; Antisense; AAGCGGTCTGGTTACGTAGCTCACC

Paste this into a BLAST search page for me
AGGCGTCCGCCAAGATGTTCATCAAGTTCATCAATTATGCCTTCACTGTGACCGCTTCTCGGTGGACACATTGGATAAGTCTTTCTAAGTGCTGTGCACAATTGTCTTTGGGTGCATCTTCGAGAACGCTGCTGGTGGTATGTCTGCACATAACGTGGCCGTTTGTGCTAATTGGGCATTGGCGTGCTGGTTGTCTATACGGATCCTAATCCTGGCAAGCATTGTAAGCATTGTGGTCTTCCTGGTCTCGAGATGCGATACTACGTGCCCGCTAGTAGCGTCTGTTTGGTTTTCTTCGGAAGAAGTTGTTCCTGCACCACAAGCGAAGCGGTCTGGTTACGTAGCTCACC

Full Affymetrix probeset data:

Annotations for 1640560_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime