FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640561_at:

>probe:Drosophila_2:1640561_at:422:345; Interrogation_Position=1048; Antisense; GCATTTACGAGCTACTCAGGAGCCA
>probe:Drosophila_2:1640561_at:642:75; Interrogation_Position=1065; Antisense; AGGAGCCAAGAGCTGCATCCGCAGT
>probe:Drosophila_2:1640561_at:598:481; Interrogation_Position=1088; Antisense; GTATTACAGCTTCAGGTGGCTCACA
>probe:Drosophila_2:1640561_at:604:91; Interrogation_Position=1129; Antisense; AGTTTCCACTGCCAGATGTACTGCG
>probe:Drosophila_2:1640561_at:269:61; Interrogation_Position=1144; Antisense; ATGTACTGCGCATTTGGGATTCCGT
>probe:Drosophila_2:1640561_at:421:197; Interrogation_Position=1251; Antisense; AACGACTTTGCCTCGAATGTGAAAC
>probe:Drosophila_2:1640561_at:580:193; Interrogation_Position=1273; Antisense; AACTCTTGCAAAACTATCCGCCAAT
>probe:Drosophila_2:1640561_at:579:59; Interrogation_Position=1306; Antisense; ATGTTGTGATTGCTCATGCCGGATC
>probe:Drosophila_2:1640561_at:497:3; Interrogation_Position=1331; Antisense; ATTGGCGTAGCATTCCTCCAGAAAT
>probe:Drosophila_2:1640561_at:129:685; Interrogation_Position=1357; Antisense; TATCCTTGTGCCCAAATGCTTGCAA
>probe:Drosophila_2:1640561_at:422:659; Interrogation_Position=1426; Antisense; TATACTTTAGTTAGCCCCAATCTTG
>probe:Drosophila_2:1640561_at:494:15; Interrogation_Position=1445; Antisense; ATCTTGGAAACGCACCCTTACAGGA
>probe:Drosophila_2:1640561_at:329:665; Interrogation_Position=1481; Antisense; TACACGCATTTTCACTTTTTTACAT
>probe:Drosophila_2:1640561_at:525:651; Interrogation_Position=997; Antisense; TCAAGTTCATGATGGCCAGGCTATC

Paste this into a BLAST search page for me
GCATTTACGAGCTACTCAGGAGCCAAGGAGCCAAGAGCTGCATCCGCAGTGTATTACAGCTTCAGGTGGCTCACAAGTTTCCACTGCCAGATGTACTGCGATGTACTGCGCATTTGGGATTCCGTAACGACTTTGCCTCGAATGTGAAACAACTCTTGCAAAACTATCCGCCAATATGTTGTGATTGCTCATGCCGGATCATTGGCGTAGCATTCCTCCAGAAATTATCCTTGTGCCCAAATGCTTGCAATATACTTTAGTTAGCCCCAATCTTGATCTTGGAAACGCACCCTTACAGGATACACGCATTTTCACTTTTTTACATTCAAGTTCATGATGGCCAGGCTATC

Full Affymetrix probeset data:

Annotations for 1640561_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720