Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640562_at:

>probe:Drosophila_2:1640562_at:174:7; Interrogation_Position=432; Antisense; ATTGATGCCCATCGTGGATCAGTCG
>probe:Drosophila_2:1640562_at:342:635; Interrogation_Position=454; Antisense; TCGCCGATCTCTGCTACTGGGAAAG
>probe:Drosophila_2:1640562_at:100:353; Interrogation_Position=478; Antisense; GCAGCTCGTTTTCGTATCTTACAGA
>probe:Drosophila_2:1640562_at:156:501; Interrogation_Position=509; Antisense; GTCGGTTTGCTAGGTGATCTTCTCA
>probe:Drosophila_2:1640562_at:457:339; Interrogation_Position=546; Antisense; GCTAACGATGATTTCTTATTTACTC
>probe:Drosophila_2:1640562_at:659:701; Interrogation_Position=561; Antisense; TTATTTACTCGTTATCTCTCGAAAG
>probe:Drosophila_2:1640562_at:561:635; Interrogation_Position=579; Antisense; TCGAAAGACTTTCGCCAGCAGTCCC
>probe:Drosophila_2:1640562_at:256:483; Interrogation_Position=636; Antisense; GTATTTGCTCTCATTGCGTTATGGT
>probe:Drosophila_2:1640562_at:428:589; Interrogation_Position=657; Antisense; TGGTAACACTACGTGATTTCGGTTT
>probe:Drosophila_2:1640562_at:674:301; Interrogation_Position=734; Antisense; CCCCAAGCACCGACAGTACATTAGT
>probe:Drosophila_2:1640562_at:484:109; Interrogation_Position=821; Antisense; AGAATTTAAATTGCGCGCCTTTTTG
>probe:Drosophila_2:1640562_at:118:625; Interrogation_Position=832; Antisense; TGCGCGCCTTTTTGATACTTGATAC
>probe:Drosophila_2:1640562_at:662:667; Interrogation_Position=847; Antisense; TACTTGATACTCTCATAAGGCGTTT
>probe:Drosophila_2:1640562_at:575:29; Interrogation_Position=876; Antisense; ATACATATCACTCCTTTCATTTCTA

Paste this into a BLAST search page for me
ATTGATGCCCATCGTGGATCAGTCGTCGCCGATCTCTGCTACTGGGAAAGGCAGCTCGTTTTCGTATCTTACAGAGTCGGTTTGCTAGGTGATCTTCTCAGCTAACGATGATTTCTTATTTACTCTTATTTACTCGTTATCTCTCGAAAGTCGAAAGACTTTCGCCAGCAGTCCCGTATTTGCTCTCATTGCGTTATGGTTGGTAACACTACGTGATTTCGGTTTCCCCAAGCACCGACAGTACATTAGTAGAATTTAAATTGCGCGCCTTTTTGTGCGCGCCTTTTTGATACTTGATACTACTTGATACTCTCATAAGGCGTTTATACATATCACTCCTTTCATTTCTA

Full Affymetrix probeset data:

Annotations for 1640562_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime