FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640565_at:

>probe:Drosophila_2:1640565_at:306:215; Interrogation_Position=111; Antisense; AAGATGATACTTGCGCTTGTCGTCC
>probe:Drosophila_2:1640565_at:7:503; Interrogation_Position=150; Antisense; GTCGCCGCCGAGGATAAGTACACCA
>probe:Drosophila_2:1640565_at:223:153; Interrogation_Position=187; Antisense; ACATCGACGTCGACGAGATCCTGAA
>probe:Drosophila_2:1640565_at:493:273; Interrogation_Position=20; Antisense; CATTTCTCAGTTAGTTCCAGCAGCT
>probe:Drosophila_2:1640565_at:123:193; Interrogation_Position=231; Antisense; AACTACTTCAAGTGCCTGGTGGACA
>probe:Drosophila_2:1640565_at:439:397; Interrogation_Position=357; Antisense; GACAAGGTCATTCGCTACATCATCG
>probe:Drosophila_2:1640565_at:377:119; Interrogation_Position=406; Antisense; AGCTGCAGGCCAAGTACGATCCCGA
>probe:Drosophila_2:1640565_at:434:607; Interrogation_Position=431; Antisense; TGAGATCTACATCAAGCGCTACCGC
>probe:Drosophila_2:1640565_at:582:363; Interrogation_Position=45; Antisense; GAATTGCTTCACATCTATTCGCTCC
>probe:Drosophila_2:1640565_at:140:33; Interrogation_Position=477; Antisense; ATCAAGGTGTAAGGCGGATCCCGGT
>probe:Drosophila_2:1640565_at:191:391; Interrogation_Position=506; Antisense; GAAACTCTTGGTTATATGCACTGTT
>probe:Drosophila_2:1640565_at:272:537; Interrogation_Position=536; Antisense; GGTCTACGCTTATATCTGATCATCA
>probe:Drosophila_2:1640565_at:306:687; Interrogation_Position=565; Antisense; TATTTCTACGATCGTGCTCGGAATA
>probe:Drosophila_2:1640565_at:672:87; Interrogation_Position=83; Antisense; AGTCGAGCCCCATTAAAACTCCAAG

Paste this into a BLAST search page for me
AAGATGATACTTGCGCTTGTCGTCCGTCGCCGCCGAGGATAAGTACACCAACATCGACGTCGACGAGATCCTGAACATTTCTCAGTTAGTTCCAGCAGCTAACTACTTCAAGTGCCTGGTGGACAGACAAGGTCATTCGCTACATCATCGAGCTGCAGGCCAAGTACGATCCCGATGAGATCTACATCAAGCGCTACCGCGAATTGCTTCACATCTATTCGCTCCATCAAGGTGTAAGGCGGATCCCGGTGAAACTCTTGGTTATATGCACTGTTGGTCTACGCTTATATCTGATCATCATATTTCTACGATCGTGCTCGGAATAAGTCGAGCCCCATTAAAACTCCAAG

Full Affymetrix probeset data:

Annotations for 1640565_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720