Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640566_at:

>probe:Drosophila_2:1640566_at:54:485; Interrogation_Position=1195; Antisense; GTATCCTTCGATTCCCATCATGGGT
>probe:Drosophila_2:1640566_at:314:65; Interrogation_Position=1214; Antisense; ATGGGTCGTCAGACACTCCAGGAAA
>probe:Drosophila_2:1640566_at:719:421; Interrogation_Position=1247; Antisense; GAGAATGGCCTAATCCTGCCGAAGC
>probe:Drosophila_2:1640566_at:189:627; Interrogation_Position=1263; Antisense; TGCCGAAGCGCTCTCAGATTAATAT
>probe:Drosophila_2:1640566_at:544:101; Interrogation_Position=1348; Antisense; AGAGCGATTCCTACCTCAGAACTGC
>probe:Drosophila_2:1640566_at:295:387; Interrogation_Position=1375; Antisense; GAAAAGGCATCCTTACGCCTACATT
>probe:Drosophila_2:1640566_at:481:519; Interrogation_Position=1469; Antisense; GTGGTCATCCTCAAGCATTTCAAGA
>probe:Drosophila_2:1640566_at:529:215; Interrogation_Position=1490; Antisense; AAGATTCTGCCTGTTATCGATCCCA
>probe:Drosophila_2:1640566_at:656:219; Interrogation_Position=1514; Antisense; AAGTCCATTGTCTTCCAAGTGGGCA
>probe:Drosophila_2:1640566_at:282:221; Interrogation_Position=1530; Antisense; AAGTGGGCATAACCTTGCGCTTCAA
>probe:Drosophila_2:1640566_at:543:543; Interrogation_Position=1613; Antisense; GGATATTCCTTATTCATGCTTACTA
>probe:Drosophila_2:1640566_at:409:441; Interrogation_Position=1673; Antisense; GATGACTAATTAACCCTGACTCTCC
>probe:Drosophila_2:1640566_at:389:611; Interrogation_Position=1689; Antisense; TGACTCTCCAGTGCTAATCGTCGTA
>probe:Drosophila_2:1640566_at:62:237; Interrogation_Position=1704; Antisense; AATCGTCGTAGCTTGGAGCCATACA

Paste this into a BLAST search page for me
GTATCCTTCGATTCCCATCATGGGTATGGGTCGTCAGACACTCCAGGAAAGAGAATGGCCTAATCCTGCCGAAGCTGCCGAAGCGCTCTCAGATTAATATAGAGCGATTCCTACCTCAGAACTGCGAAAAGGCATCCTTACGCCTACATTGTGGTCATCCTCAAGCATTTCAAGAAAGATTCTGCCTGTTATCGATCCCAAAGTCCATTGTCTTCCAAGTGGGCAAAGTGGGCATAACCTTGCGCTTCAAGGATATTCCTTATTCATGCTTACTAGATGACTAATTAACCCTGACTCTCCTGACTCTCCAGTGCTAATCGTCGTAAATCGTCGTAGCTTGGAGCCATACA

Full Affymetrix probeset data:

Annotations for 1640566_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime