FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640567_at:

>probe:Drosophila_2:1640567_at:590:441; Interrogation_Position=4551; Antisense; GATGGTCAACAACTGTGCCGATCTT
>probe:Drosophila_2:1640567_at:2:317; Interrogation_Position=4567; Antisense; GCCGATCTTTTGAGCAATTTACGCA
>probe:Drosophila_2:1640567_at:355:697; Interrogation_Position=4584; Antisense; TTTACGCACGAAGCACAAACCCGAT
>probe:Drosophila_2:1640567_at:634:321; Interrogation_Position=4679; Antisense; GCGGGAAGGACTAACCAACACCTAT
>probe:Drosophila_2:1640567_at:462:687; Interrogation_Position=4705; Antisense; TATTTAACTGAACCCACACACACAC
>probe:Drosophila_2:1640567_at:189:13; Interrogation_Position=4816; Antisense; ATTAGTTCAATTTGCGTAGCCGCTA
>probe:Drosophila_2:1640567_at:308:487; Interrogation_Position=4831; Antisense; GTAGCCGCTAAGTTTTCTGTTTCGT
>probe:Drosophila_2:1640567_at:304:699; Interrogation_Position=4843; Antisense; TTTTCTGTTTCGTTTTTGTGCGCGT
>probe:Drosophila_2:1640567_at:389:597; Interrogation_Position=4859; Antisense; TGTGCGCGTGTGCATTTCTTTTAAC
>probe:Drosophila_2:1640567_at:116:61; Interrogation_Position=4894; Antisense; ATGTCAACCGATTGCGTTTAGCTTG
>probe:Drosophila_2:1640567_at:650:255; Interrogation_Position=5042; Antisense; CAAAGTGCGCTTAGTCTATGCCTTC
>probe:Drosophila_2:1640567_at:168:499; Interrogation_Position=5055; Antisense; GTCTATGCCTTCTTTCTGTATGATT
>probe:Drosophila_2:1640567_at:393:715; Interrogation_Position=5082; Antisense; TTCTCTCTTTTTGTTAACGTTCTGT
>probe:Drosophila_2:1640567_at:690:197; Interrogation_Position=5097; Antisense; AACGTTCTGTTTGCGAATCACTCCA

Paste this into a BLAST search page for me
GATGGTCAACAACTGTGCCGATCTTGCCGATCTTTTGAGCAATTTACGCATTTACGCACGAAGCACAAACCCGATGCGGGAAGGACTAACCAACACCTATTATTTAACTGAACCCACACACACACATTAGTTCAATTTGCGTAGCCGCTAGTAGCCGCTAAGTTTTCTGTTTCGTTTTTCTGTTTCGTTTTTGTGCGCGTTGTGCGCGTGTGCATTTCTTTTAACATGTCAACCGATTGCGTTTAGCTTGCAAAGTGCGCTTAGTCTATGCCTTCGTCTATGCCTTCTTTCTGTATGATTTTCTCTCTTTTTGTTAACGTTCTGTAACGTTCTGTTTGCGAATCACTCCA

Full Affymetrix probeset data:

Annotations for 1640567_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720