Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640568_at:

>probe:Drosophila_2:1640568_at:472:113; Interrogation_Position=1290; Antisense; AGCGTCCCATGGATCCCAGGTTAAG
>probe:Drosophila_2:1640568_at:135:539; Interrogation_Position=1308; Antisense; GGTTAAGGGCAGGACCTGGTCCTCA
>probe:Drosophila_2:1640568_at:483:469; Interrogation_Position=1405; Antisense; GTTGCAGAGCAGACTAGGCGCCCAT
>probe:Drosophila_2:1640568_at:698:639; Interrogation_Position=1442; Antisense; TCGGATGCCTCCGACCAGGAGAAGG
>probe:Drosophila_2:1640568_at:359:371; Interrogation_Position=1462; Antisense; GAAGGCTGCCCTCATCATGCAGGTA
>probe:Drosophila_2:1640568_at:600:77; Interrogation_Position=1482; Antisense; AGGTACTGCAGCTGTCCGACGAACA
>probe:Drosophila_2:1640568_at:230:197; Interrogation_Position=1530; Antisense; AACGGGTCAGTATTGTCATGCTCAA
>probe:Drosophila_2:1640568_at:493:419; Interrogation_Position=1556; Antisense; GAGCAGATTGCGAAGAGTACCCAGC
>probe:Drosophila_2:1640568_at:717:123; Interrogation_Position=1578; Antisense; AGCGCTGAAACTACTCTGGCTGAAA
>probe:Drosophila_2:1640568_at:367:181; Interrogation_Position=1609; Antisense; AAAAATCACCATTTCGCTCATGCAT
>probe:Drosophila_2:1640568_at:316:695; Interrogation_Position=1620; Antisense; TTTCGCTCATGCATACTATAGTACT
>probe:Drosophila_2:1640568_at:654:403; Interrogation_Position=1729; Antisense; GACTAGGGTCTGGTGTAACTTCTGA
>probe:Drosophila_2:1640568_at:588:189; Interrogation_Position=1745; Antisense; AACTTCTGAACCGTCGTATTGAGCA
>probe:Drosophila_2:1640568_at:726:1; Interrogation_Position=1762; Antisense; ATTGAGCATTTGTCGCAGCACATCA

Paste this into a BLAST search page for me
AGCGTCCCATGGATCCCAGGTTAAGGGTTAAGGGCAGGACCTGGTCCTCAGTTGCAGAGCAGACTAGGCGCCCATTCGGATGCCTCCGACCAGGAGAAGGGAAGGCTGCCCTCATCATGCAGGTAAGGTACTGCAGCTGTCCGACGAACAAACGGGTCAGTATTGTCATGCTCAAGAGCAGATTGCGAAGAGTACCCAGCAGCGCTGAAACTACTCTGGCTGAAAAAAAATCACCATTTCGCTCATGCATTTTCGCTCATGCATACTATAGTACTGACTAGGGTCTGGTGTAACTTCTGAAACTTCTGAACCGTCGTATTGAGCAATTGAGCATTTGTCGCAGCACATCA

Full Affymetrix probeset data:

Annotations for 1640568_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime