FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640569_at:

>probe:Drosophila_2:1640569_at:103:69; Interrogation_Position=144; Antisense; ATGGCTGTACTCGATGCCCTGGCGT
>probe:Drosophila_2:1640569_at:617:641; Interrogation_Position=207; Antisense; TCTGACGGCGCTGGCTCAACTGAGT
>probe:Drosophila_2:1640569_at:387:651; Interrogation_Position=222; Antisense; TCAACTGAGTCCTGGCTACACGGGC
>probe:Drosophila_2:1640569_at:727:93; Interrogation_Position=264; Antisense; AGTTCCACAGGATCAACGCCAGCAG
>probe:Drosophila_2:1640569_at:158:247; Interrogation_Position=320; Antisense; AATTCCAGCAGGCATATCCGCAGCA
>probe:Drosophila_2:1640569_at:419:359; Interrogation_Position=351; Antisense; GCAACAGCGATACCAGCAGGAATAT
>probe:Drosophila_2:1640569_at:323:269; Interrogation_Position=367; Antisense; CAGGAATATCCGCAGCAATACCAGC
>probe:Drosophila_2:1640569_at:644:593; Interrogation_Position=407; Antisense; TGGGCTTATTTACTCCTCAACTGCA
>probe:Drosophila_2:1640569_at:568:71; Interrogation_Position=461; Antisense; AGGCTGGACATTTTAGCCTGCCCTT
>probe:Drosophila_2:1640569_at:287:425; Interrogation_Position=521; Antisense; GAGATGAACATATAGCCCAAGGGCA
>probe:Drosophila_2:1640569_at:161:197; Interrogation_Position=550; Antisense; AACGGCATGCCAGAGCAAACGTCGC
>probe:Drosophila_2:1640569_at:14:359; Interrogation_Position=564; Antisense; GCAAACGTCGCAGCGGACACTGGAG
>probe:Drosophila_2:1640569_at:588:547; Interrogation_Position=585; Antisense; GGAGGAGCCGACCTTCCATGAGCAT
>probe:Drosophila_2:1640569_at:21:339; Interrogation_Position=656; Antisense; GCTACGTCTATCTATCGCCTAGTAA

Paste this into a BLAST search page for me
ATGGCTGTACTCGATGCCCTGGCGTTCTGACGGCGCTGGCTCAACTGAGTTCAACTGAGTCCTGGCTACACGGGCAGTTCCACAGGATCAACGCCAGCAGAATTCCAGCAGGCATATCCGCAGCAGCAACAGCGATACCAGCAGGAATATCAGGAATATCCGCAGCAATACCAGCTGGGCTTATTTACTCCTCAACTGCAAGGCTGGACATTTTAGCCTGCCCTTGAGATGAACATATAGCCCAAGGGCAAACGGCATGCCAGAGCAAACGTCGCGCAAACGTCGCAGCGGACACTGGAGGGAGGAGCCGACCTTCCATGAGCATGCTACGTCTATCTATCGCCTAGTAA

Full Affymetrix probeset data:

Annotations for 1640569_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720