FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640571_at:

>probe:Drosophila_2:1640571_at:274:115; Interrogation_Position=1027; Antisense; AGCAGTGCCTGGTATACTTGGGATC
>probe:Drosophila_2:1640571_at:483:69; Interrogation_Position=1063; Antisense; AGGCGGGTCTTTCTCATTATCCTGC
>probe:Drosophila_2:1640571_at:124:699; Interrogation_Position=1121; Antisense; TTTTTGCACCATCGTTACCAGTCTT
>probe:Drosophila_2:1640571_at:281:267; Interrogation_Position=1139; Antisense; CAGTCTTCACATCGGTCATCAAGTT
>probe:Drosophila_2:1640571_at:43:521; Interrogation_Position=1177; Antisense; GTGGCACTGGCTAAGACGATACTGT
>probe:Drosophila_2:1640571_at:191:287; Interrogation_Position=611; Antisense; CTGTGTACGCCTTTGCTGGTACAGA
>probe:Drosophila_2:1640571_at:303:723; Interrogation_Position=673; Antisense; TTGCTGCAGGCCTTAAGATACGATA
>probe:Drosophila_2:1640571_at:34:527; Interrogation_Position=737; Antisense; GGGAATCCAAAATCTGCTGTCAGCG
>probe:Drosophila_2:1640571_at:135:15; Interrogation_Position=823; Antisense; ATTATGGCTGCTCCAACTTTTGTTC
>probe:Drosophila_2:1640571_at:5:149; Interrogation_Position=838; Antisense; ACTTTTGTTCACTTCGTATCAGCCA
>probe:Drosophila_2:1640571_at:245:27; Interrogation_Position=871; Antisense; ATAGCCACCAGCGTCATTGATATAC
>probe:Drosophila_2:1640571_at:445:717; Interrogation_Position=903; Antisense; TTCCGGCTATAACATCATCCGTTAC
>probe:Drosophila_2:1640571_at:640:643; Interrogation_Position=925; Antisense; TACGTGGTGTACACCTTCACGGTTT
>probe:Drosophila_2:1640571_at:276:195; Interrogation_Position=993; Antisense; AACTGAGAGCCTTTCCTTGGGAGAA

Paste this into a BLAST search page for me
AGCAGTGCCTGGTATACTTGGGATCAGGCGGGTCTTTCTCATTATCCTGCTTTTTGCACCATCGTTACCAGTCTTCAGTCTTCACATCGGTCATCAAGTTGTGGCACTGGCTAAGACGATACTGTCTGTGTACGCCTTTGCTGGTACAGATTGCTGCAGGCCTTAAGATACGATAGGGAATCCAAAATCTGCTGTCAGCGATTATGGCTGCTCCAACTTTTGTTCACTTTTGTTCACTTCGTATCAGCCAATAGCCACCAGCGTCATTGATATACTTCCGGCTATAACATCATCCGTTACTACGTGGTGTACACCTTCACGGTTTAACTGAGAGCCTTTCCTTGGGAGAA

Full Affymetrix probeset data:

Annotations for 1640571_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720