FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640574_at:

>probe:Drosophila_2:1640574_at:398:263; Interrogation_Position=159; Antisense; CAGCTTACCGCCAAGATCATGAACT
>probe:Drosophila_2:1640574_at:715:247; Interrogation_Position=19; Antisense; AATTGTTCTGCAATTGCCCTCAGTG
>probe:Drosophila_2:1640574_at:424:193; Interrogation_Position=201; Antisense; AACTACAATCAACTGCGCAAGGGAG
>probe:Drosophila_2:1640574_at:46:653; Interrogation_Position=247; Antisense; TCAATCGCGGACTGGCCGATATTGT
>probe:Drosophila_2:1640574_at:517:123; Interrogation_Position=292; Antisense; AGCCCATCGAGATTCTGCTCCATTT
>probe:Drosophila_2:1640574_at:338:19; Interrogation_Position=313; Antisense; ATTTGCCGCTCCTGTGCGAGGACAA
>probe:Drosophila_2:1640574_at:560:625; Interrogation_Position=33; Antisense; TGCCCTCAGTGAAGCAGCAAGCGGA
>probe:Drosophila_2:1640574_at:180:73; Interrogation_Position=331; Antisense; AGGACAAGAACGTGCCCTACGTCTT
>probe:Drosophila_2:1640574_at:255:669; Interrogation_Position=348; Antisense; TACGTCTTCGTTCGTTCCAAGCAGG
>probe:Drosophila_2:1640574_at:232:323; Interrogation_Position=384; Antisense; GCGTGCGGAGTTTCCCGGCCAATAG
>probe:Drosophila_2:1640574_at:460:311; Interrogation_Position=402; Antisense; CCAATAGTCGCCTGCTCTGTGACCA
>probe:Drosophila_2:1640574_at:323:137; Interrogation_Position=430; Antisense; ACGAGGGCAGCCAGCTCAAGTCGCA
>probe:Drosophila_2:1640574_at:307:653; Interrogation_Position=445; Antisense; TCAAGTCGCAGATCACCTCCATTCA
>probe:Drosophila_2:1640574_at:42:325; Interrogation_Position=482; Antisense; GCGACTGCTAGTCTAGTAACCCTTT

Paste this into a BLAST search page for me
CAGCTTACCGCCAAGATCATGAACTAATTGTTCTGCAATTGCCCTCAGTGAACTACAATCAACTGCGCAAGGGAGTCAATCGCGGACTGGCCGATATTGTAGCCCATCGAGATTCTGCTCCATTTATTTGCCGCTCCTGTGCGAGGACAATGCCCTCAGTGAAGCAGCAAGCGGAAGGACAAGAACGTGCCCTACGTCTTTACGTCTTCGTTCGTTCCAAGCAGGGCGTGCGGAGTTTCCCGGCCAATAGCCAATAGTCGCCTGCTCTGTGACCAACGAGGGCAGCCAGCTCAAGTCGCATCAAGTCGCAGATCACCTCCATTCAGCGACTGCTAGTCTAGTAACCCTTT

Full Affymetrix probeset data:

Annotations for 1640574_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720