FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640575_at:

>probe:Drosophila_2:1640575_at:687:591; Interrogation_Position=1031; Antisense; TGGTGAGCATCTTTGGCATTTTCCT
>probe:Drosophila_2:1640575_at:20:407; Interrogation_Position=1094; Antisense; GACTGCTGGACTATATGACCTATTT
>probe:Drosophila_2:1640575_at:330:513; Interrogation_Position=1123; Antisense; GTGATTTGGAGCTTCACCACCATGA
>probe:Drosophila_2:1640575_at:369:85; Interrogation_Position=1161; Antisense; AGTGCTTCGACTATGCTGCAATGCC
>probe:Drosophila_2:1640575_at:247:87; Interrogation_Position=1283; Antisense; AGTCATTCACACTGCAGTTTCTTCA
>probe:Drosophila_2:1640575_at:241:713; Interrogation_Position=1301; Antisense; TTCTTCACTGGGAGGGTTTCTTTCA
>probe:Drosophila_2:1640575_at:98:529; Interrogation_Position=1338; Antisense; GGGATTGTTTGCTCTGGACTACACA
>probe:Drosophila_2:1640575_at:625:403; Interrogation_Position=1354; Antisense; GACTACACATTCATTTTCTCGACTG
>probe:Drosophila_2:1640575_at:266:407; Interrogation_Position=1374; Antisense; GACTGTAAGTGCAGCCACATCCTAT
>probe:Drosophila_2:1640575_at:348:47; Interrogation_Position=1392; Antisense; ATCCTATTTAATTGTCCTGCTGCAG
>probe:Drosophila_2:1640575_at:561:611; Interrogation_Position=879; Antisense; TGACAATGCCACCATCGCGGAAAAT
>probe:Drosophila_2:1640575_at:341:639; Interrogation_Position=916; Antisense; TCGGAAGCCAATTTACCAGATCTCT
>probe:Drosophila_2:1640575_at:269:347; Interrogation_Position=948; Antisense; GCATGATAAAATCCTGGCGCTCAGC
>probe:Drosophila_2:1640575_at:620:153; Interrogation_Position=999; Antisense; ACAGTGTGTACCCTATATGGCGGCC

Paste this into a BLAST search page for me
TGGTGAGCATCTTTGGCATTTTCCTGACTGCTGGACTATATGACCTATTTGTGATTTGGAGCTTCACCACCATGAAGTGCTTCGACTATGCTGCAATGCCAGTCATTCACACTGCAGTTTCTTCATTCTTCACTGGGAGGGTTTCTTTCAGGGATTGTTTGCTCTGGACTACACAGACTACACATTCATTTTCTCGACTGGACTGTAAGTGCAGCCACATCCTATATCCTATTTAATTGTCCTGCTGCAGTGACAATGCCACCATCGCGGAAAATTCGGAAGCCAATTTACCAGATCTCTGCATGATAAAATCCTGGCGCTCAGCACAGTGTGTACCCTATATGGCGGCC

Full Affymetrix probeset data:

Annotations for 1640575_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720