FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640579_at:

>probe:Drosophila_2:1640579_at:241:263; Interrogation_Position=429; Antisense; CAGCAGTAGCTCTTCGTCATCCAAG
>probe:Drosophila_2:1640579_at:570:717; Interrogation_Position=441; Antisense; TTCGTCATCCAAGCGGAACCGCAAG
>probe:Drosophila_2:1640579_at:174:251; Interrogation_Position=462; Antisense; CAAGGAGAGGCGTCGTCGCTACCGA
>probe:Drosophila_2:1640579_at:408:131; Interrogation_Position=482; Antisense; ACCGACGTCGTCAGAGACGCCAGGA
>probe:Drosophila_2:1640579_at:587:649; Interrogation_Position=492; Antisense; TCAGAGACGCCAGGAGAGACGCCGT
>probe:Drosophila_2:1640579_at:6:125; Interrogation_Position=542; Antisense; AGCGCCAGCCTCAAAGTCCTTGGAC
>probe:Drosophila_2:1640579_at:92:201; Interrogation_Position=569; Antisense; AACGCTACCTGGTCATCTCACGGCT
>probe:Drosophila_2:1640579_at:122:39; Interrogation_Position=583; Antisense; ATCTCACGGCTTCTGCTGGATTCAC
>probe:Drosophila_2:1640579_at:708:589; Interrogation_Position=599; Antisense; TGGATTCACTGCCTCTAGGCGAAGT
>probe:Drosophila_2:1640579_at:729:87; Interrogation_Position=816; Antisense; AGTAGACGTAGTGCTATTGCTGGAC
>probe:Drosophila_2:1640579_at:728:643; Interrogation_Position=824; Antisense; TAGTGCTATTGCTGGACGGAGTTGA
>probe:Drosophila_2:1640579_at:305:135; Interrogation_Position=857; Antisense; ACGAAGAGCTGGGTGTCGAACTTGA
>probe:Drosophila_2:1640579_at:674:295; Interrogation_Position=873; Antisense; CGAACTTGAGCTGGAAGTCGATGGA
>probe:Drosophila_2:1640579_at:17:283; Interrogation_Position=940; Antisense; CTCGAGGATGAGTCGGTGCCACCAT

Paste this into a BLAST search page for me
CAGCAGTAGCTCTTCGTCATCCAAGTTCGTCATCCAAGCGGAACCGCAAGCAAGGAGAGGCGTCGTCGCTACCGAACCGACGTCGTCAGAGACGCCAGGATCAGAGACGCCAGGAGAGACGCCGTAGCGCCAGCCTCAAAGTCCTTGGACAACGCTACCTGGTCATCTCACGGCTATCTCACGGCTTCTGCTGGATTCACTGGATTCACTGCCTCTAGGCGAAGTAGTAGACGTAGTGCTATTGCTGGACTAGTGCTATTGCTGGACGGAGTTGAACGAAGAGCTGGGTGTCGAACTTGACGAACTTGAGCTGGAAGTCGATGGACTCGAGGATGAGTCGGTGCCACCAT

Full Affymetrix probeset data:

Annotations for 1640579_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720