FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640580_at:

>probe:Drosophila_2:1640580_at:390:549; Interrogation_Position=1320; Antisense; GGAGGATCTGCTGCGATCTCATATA
>probe:Drosophila_2:1640580_at:98:677; Interrogation_Position=1371; Antisense; TAGACAGTTTTTCCTGGAGGCCAAT
>probe:Drosophila_2:1640580_at:496:571; Interrogation_Position=1438; Antisense; GGCTACAGCGATGATTTGACCTCTC
>probe:Drosophila_2:1640580_at:565:693; Interrogation_Position=1452; Antisense; TTTGACCTCTCGCATAGCCAAGGGA
>probe:Drosophila_2:1640580_at:227:675; Interrogation_Position=1466; Antisense; TAGCCAAGGGACAGTGCGCCTACTA
>probe:Drosophila_2:1640580_at:93:713; Interrogation_Position=1501; Antisense; TTCTATCTGCGCTACTTACGAGTGG
>probe:Drosophila_2:1640580_at:688:543; Interrogation_Position=1537; Antisense; GGATCAGCTCTCCACATCATGAAGG
>probe:Drosophila_2:1640580_at:366:71; Interrogation_Position=1559; Antisense; AGGAATGTGTCCTCTATATGCCCGT
>probe:Drosophila_2:1640580_at:695:23; Interrogation_Position=1574; Antisense; ATATGCCCGTAGTGCTGGCCATGGA
>probe:Drosophila_2:1640580_at:170:613; Interrogation_Position=1613; Antisense; TGAAGCCACGGGTAGATGCCTCCAT
>probe:Drosophila_2:1640580_at:466:49; Interrogation_Position=1628; Antisense; ATGCCTCCATTCAACATCTGGCGGA
>probe:Drosophila_2:1640580_at:342:163; Interrogation_Position=1744; Antisense; AAATTCTGGAGCTCTTTTGTGGCCT
>probe:Drosophila_2:1640580_at:653:521; Interrogation_Position=1762; Antisense; GTGGCCTTGCTGATTGGTTACGTAA
>probe:Drosophila_2:1640580_at:442:233; Interrogation_Position=1791; Antisense; AATGCTTACACTGCTCGCTGAAAGA

Paste this into a BLAST search page for me
GGAGGATCTGCTGCGATCTCATATATAGACAGTTTTTCCTGGAGGCCAATGGCTACAGCGATGATTTGACCTCTCTTTGACCTCTCGCATAGCCAAGGGATAGCCAAGGGACAGTGCGCCTACTATTCTATCTGCGCTACTTACGAGTGGGGATCAGCTCTCCACATCATGAAGGAGGAATGTGTCCTCTATATGCCCGTATATGCCCGTAGTGCTGGCCATGGATGAAGCCACGGGTAGATGCCTCCATATGCCTCCATTCAACATCTGGCGGAAAATTCTGGAGCTCTTTTGTGGCCTGTGGCCTTGCTGATTGGTTACGTAAAATGCTTACACTGCTCGCTGAAAGA

Full Affymetrix probeset data:

Annotations for 1640580_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720