FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640582_at:

>probe:Drosophila_2:1640582_at:35:595; Interrogation_Position=1557; Antisense; TGGGCAGCTCACACATCGAGGGAAT
>probe:Drosophila_2:1640582_at:444:119; Interrogation_Position=1587; Antisense; AGCTGACCAGCTCGGAGTTTGACAA
>probe:Drosophila_2:1640582_at:383:9; Interrogation_Position=1612; Antisense; ATTCCTAGAGGAGAGAGCCGCTGCC
>probe:Drosophila_2:1640582_at:491:319; Interrogation_Position=1637; Antisense; GCCGAGAATCTTCCAACGATCAGTG
>probe:Drosophila_2:1640582_at:561:197; Interrogation_Position=1651; Antisense; AACGATCAGTGCATCGAACTCCGCC
>probe:Drosophila_2:1640582_at:106:289; Interrogation_Position=1695; Antisense; CGGCAGGAGCCGATAGCTTACGAAA
>probe:Drosophila_2:1640582_at:327:451; Interrogation_Position=1748; Antisense; GATCTGCTCGCGCTCTGAGTGATCT
>probe:Drosophila_2:1640582_at:610:261; Interrogation_Position=1780; Antisense; CACCATCATCGGCTCTAATTGTTTA
>probe:Drosophila_2:1640582_at:216:573; Interrogation_Position=1790; Antisense; GGCTCTAATTGTTTACTCTTTCAAA
>probe:Drosophila_2:1640582_at:552:685; Interrogation_Position=1818; Antisense; TATACACACCCTAACATACTTATCC
>probe:Drosophila_2:1640582_at:212:47; Interrogation_Position=1839; Antisense; ATCCGTAACGTCTATTTGATAGCAG
>probe:Drosophila_2:1640582_at:283:123; Interrogation_Position=1947; Antisense; AGCGATCTTTTGTTGGTCTAATTGT
>probe:Drosophila_2:1640582_at:222:493; Interrogation_Position=1970; Antisense; GTAAGCCACGTCTACACATTGATGG
>probe:Drosophila_2:1640582_at:326:395; Interrogation_Position=2098; Antisense; GAAATACATTTCAAGCACATACCGA

Paste this into a BLAST search page for me
TGGGCAGCTCACACATCGAGGGAATAGCTGACCAGCTCGGAGTTTGACAAATTCCTAGAGGAGAGAGCCGCTGCCGCCGAGAATCTTCCAACGATCAGTGAACGATCAGTGCATCGAACTCCGCCCGGCAGGAGCCGATAGCTTACGAAAGATCTGCTCGCGCTCTGAGTGATCTCACCATCATCGGCTCTAATTGTTTAGGCTCTAATTGTTTACTCTTTCAAATATACACACCCTAACATACTTATCCATCCGTAACGTCTATTTGATAGCAGAGCGATCTTTTGTTGGTCTAATTGTGTAAGCCACGTCTACACATTGATGGGAAATACATTTCAAGCACATACCGA

Full Affymetrix probeset data:

Annotations for 1640582_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720