FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640585_at:

>probe:Drosophila_2:1640585_at:343:263; Interrogation_Position=5020; Antisense; CAGCATAGTGCCGAAAGCGCCGATG
>probe:Drosophila_2:1640585_at:499:45; Interrogation_Position=5136; Antisense; ATCCCTAATCCCAGTGCCAGTGAAT
>probe:Drosophila_2:1640585_at:416:299; Interrogation_Position=5166; Antisense; CGCCAGCTATGAGTATCGCACCAAG
>probe:Drosophila_2:1640585_at:200:353; Interrogation_Position=5183; Antisense; GCACCAAGCTGCAGATGATACCGCC
>probe:Drosophila_2:1640585_at:252:239; Interrogation_Position=5218; Antisense; AATCAGTCCACCCTGAGGTGTCGCA
>probe:Drosophila_2:1640585_at:204:517; Interrogation_Position=5235; Antisense; GTGTCGCAGTGTGGCCCGCAAGAAA
>probe:Drosophila_2:1640585_at:342:673; Interrogation_Position=5311; Antisense; TATTTGCCGGCCAAACGGAACTCGA
>probe:Drosophila_2:1640585_at:89:563; Interrogation_Position=5327; Antisense; GGAACTCGAGTGTTAGCCATGTCTA
>probe:Drosophila_2:1640585_at:35:193; Interrogation_Position=5356; Antisense; AACTATCTGCTGTATGCCACCAGCG
>probe:Drosophila_2:1640585_at:536:535; Interrogation_Position=5389; Antisense; GGTAAGGCGGACAAGCTGCGTCCAT
>probe:Drosophila_2:1640585_at:145:337; Interrogation_Position=5403; Antisense; GCTGCGTCCATACCAAAACAATCTG
>probe:Drosophila_2:1640585_at:322:263; Interrogation_Position=5443; Antisense; CAGCTTTTTGGTGCATCGGCGACAG
>probe:Drosophila_2:1640585_at:123:495; Interrogation_Position=5528; Antisense; GTCAAGTGCGCAGCAGTGTGTCCAC
>probe:Drosophila_2:1640585_at:550:9; Interrogation_Position=5562; Antisense; ATTCGGCATCTGCACATGTTCATAG

Paste this into a BLAST search page for me
CAGCATAGTGCCGAAAGCGCCGATGATCCCTAATCCCAGTGCCAGTGAATCGCCAGCTATGAGTATCGCACCAAGGCACCAAGCTGCAGATGATACCGCCAATCAGTCCACCCTGAGGTGTCGCAGTGTCGCAGTGTGGCCCGCAAGAAATATTTGCCGGCCAAACGGAACTCGAGGAACTCGAGTGTTAGCCATGTCTAAACTATCTGCTGTATGCCACCAGCGGGTAAGGCGGACAAGCTGCGTCCATGCTGCGTCCATACCAAAACAATCTGCAGCTTTTTGGTGCATCGGCGACAGGTCAAGTGCGCAGCAGTGTGTCCACATTCGGCATCTGCACATGTTCATAG

Full Affymetrix probeset data:

Annotations for 1640585_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720