FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640586_at:

>probe:Drosophila_2:1640586_at:113:517; Interrogation_Position=231; Antisense; GTGTGTTTGTGAATGCACGCCGGAA
>probe:Drosophila_2:1640586_at:189:163; Interrogation_Position=262; Antisense; AAATTAGTGACTTACATCTTCATCG
>probe:Drosophila_2:1640586_at:151:583; Interrogation_Position=304; Antisense; TGGTACCTCCTGCTTTTCGGTGGCA
>probe:Drosophila_2:1640586_at:53:645; Interrogation_Position=369; Antisense; TCAGCTGGAGGGACGGGACTTTCAT
>probe:Drosophila_2:1640586_at:712:407; Interrogation_Position=380; Antisense; GACGGGACTTTCATCACCATGGCGG
>probe:Drosophila_2:1640586_at:381:89; Interrogation_Position=406; Antisense; AGTCACCACATTCGCCGTAACATTA
>probe:Drosophila_2:1640586_at:567:659; Interrogation_Position=423; Antisense; TAACATTAACCATTGCTGGCGCCGT
>probe:Drosophila_2:1640586_at:344:577; Interrogation_Position=440; Antisense; GGCGCCGTTACGATGGCTACAATCT
>probe:Drosophila_2:1640586_at:58:239; Interrogation_Position=460; Antisense; AATCTGCAGAACACTGTGGTCAACA
>probe:Drosophila_2:1640586_at:508:379; Interrogation_Position=501; Antisense; GAAGCCCTATGGCATATTGTGCAAC
>probe:Drosophila_2:1640586_at:175:359; Interrogation_Position=521; Antisense; GCAACTTCAAGTGCACCTGGTTCTT
>probe:Drosophila_2:1640586_at:291:259; Interrogation_Position=561; Antisense; CACTTGCGAGTTCATCTACGATTAT
>probe:Drosophila_2:1640586_at:587:29; Interrogation_Position=584; Antisense; ATAAGTTATCCTGCGTGCTGTTCAC
>probe:Drosophila_2:1640586_at:463:487; Interrogation_Position=623; Antisense; GTACCAGCGTCCAGTGTACGCTTAT

Paste this into a BLAST search page for me
GTGTGTTTGTGAATGCACGCCGGAAAAATTAGTGACTTACATCTTCATCGTGGTACCTCCTGCTTTTCGGTGGCATCAGCTGGAGGGACGGGACTTTCATGACGGGACTTTCATCACCATGGCGGAGTCACCACATTCGCCGTAACATTATAACATTAACCATTGCTGGCGCCGTGGCGCCGTTACGATGGCTACAATCTAATCTGCAGAACACTGTGGTCAACAGAAGCCCTATGGCATATTGTGCAACGCAACTTCAAGTGCACCTGGTTCTTCACTTGCGAGTTCATCTACGATTATATAAGTTATCCTGCGTGCTGTTCACGTACCAGCGTCCAGTGTACGCTTAT

Full Affymetrix probeset data:

Annotations for 1640586_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720