FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640587_at:

>probe:Drosophila_2:1640587_at:481:601; Interrogation_Position=282; Antisense; TGTTTACGACCCTGAATCCACACGA
>probe:Drosophila_2:1640587_at:238:49; Interrogation_Position=297; Antisense; ATCCACACGACCCTACGAGTATATG
>probe:Drosophila_2:1640587_at:125:23; Interrogation_Position=317; Antisense; ATATGTGCACTATACGTTGTCCTCC
>probe:Drosophila_2:1640587_at:597:333; Interrogation_Position=374; Antisense; GCTGGTGGGTTCTGTCTGGCTTCAT
>probe:Drosophila_2:1640587_at:299:157; Interrogation_Position=512; Antisense; ACACCACCGTCGAGTCCAGGGAGAA
>probe:Drosophila_2:1640587_at:477:107; Interrogation_Position=533; Antisense; AGAACAATATCATACCCTCATCACG
>probe:Drosophila_2:1640587_at:7:199; Interrogation_Position=607; Antisense; AACGATTTATATCCAGGCTCGGCCT
>probe:Drosophila_2:1640587_at:641:349; Interrogation_Position=684; Antisense; GCAGACCTCGGCATTGCCAGGAGGA
>probe:Drosophila_2:1640587_at:213:679; Interrogation_Position=720; Antisense; TAGTCTATCATCGATGGGCTCCAAA
>probe:Drosophila_2:1640587_at:48:73; Interrogation_Position=759; Antisense; AGGCAAGAGCACGTTCTACACAGAA
>probe:Drosophila_2:1640587_at:716:375; Interrogation_Position=781; Antisense; GAACGACCACCGAATGAGTACGCCG
>probe:Drosophila_2:1640587_at:256:579; Interrogation_Position=819; Antisense; TGGCCTGCTGCTTCATAGAGCATTG
>probe:Drosophila_2:1640587_at:44:117; Interrogation_Position=837; Antisense; AGCATTGCTGTTCGGCTCTGGAATC
>probe:Drosophila_2:1640587_at:415:585; Interrogation_Position=855; Antisense; TGGAATCTATCTGACCCTGCTTTGA

Paste this into a BLAST search page for me
TGTTTACGACCCTGAATCCACACGAATCCACACGACCCTACGAGTATATGATATGTGCACTATACGTTGTCCTCCGCTGGTGGGTTCTGTCTGGCTTCATACACCACCGTCGAGTCCAGGGAGAAAGAACAATATCATACCCTCATCACGAACGATTTATATCCAGGCTCGGCCTGCAGACCTCGGCATTGCCAGGAGGATAGTCTATCATCGATGGGCTCCAAAAGGCAAGAGCACGTTCTACACAGAAGAACGACCACCGAATGAGTACGCCGTGGCCTGCTGCTTCATAGAGCATTGAGCATTGCTGTTCGGCTCTGGAATCTGGAATCTATCTGACCCTGCTTTGA

Full Affymetrix probeset data:

Annotations for 1640587_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720