Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640589_at:

>probe:Drosophila_2:1640589_at:516:391; Interrogation_Position=4578; Antisense; GAAACGTGGTGCTGTCCTCAGTCAA
>probe:Drosophila_2:1640589_at:565:231; Interrogation_Position=4601; Antisense; AATGACACTCCGCTGATTGTTTACC
>probe:Drosophila_2:1640589_at:162:623; Interrogation_Position=4628; Antisense; TCCAATATTCACACAAAGGGCCTTT
>probe:Drosophila_2:1640589_at:216:221; Interrogation_Position=4643; Antisense; AAGGGCCTTTTGCAATACCGTGACG
>probe:Drosophila_2:1640589_at:237:355; Interrogation_Position=4763; Antisense; GCACCGACTAATTTCAACCACATTT
>probe:Drosophila_2:1640589_at:320:159; Interrogation_Position=4816; Antisense; AAATCAACGACTCCTAGACTTACCA
>probe:Drosophila_2:1640589_at:535:389; Interrogation_Position=4850; Antisense; GAAACAGCCGATCAAGCCTGCAGTC
>probe:Drosophila_2:1640589_at:582:125; Interrogation_Position=4864; Antisense; AGCCTGCAGTCCAATAATACATTCG
>probe:Drosophila_2:1640589_at:598:29; Interrogation_Position=4880; Antisense; ATACATTCGCTGAGTTGCATACCCC
>probe:Drosophila_2:1640589_at:511:193; Interrogation_Position=4943; Antisense; AACTCCGATGACTATGGCAATGACA
>probe:Drosophila_2:1640589_at:421:611; Interrogation_Position=4963; Antisense; TGACAACATTATCTCCAGAACGCCC
>probe:Drosophila_2:1640589_at:549:85; Interrogation_Position=4988; Antisense; AGTCCAATGGCATCGTCCTTCATGG
>probe:Drosophila_2:1640589_at:300:505; Interrogation_Position=5002; Antisense; GTCCTTCATGGACGGCTTAAGCAAT
>probe:Drosophila_2:1640589_at:254:661; Interrogation_Position=5033; Antisense; TAACTTCAGTCAATCTCTACACGTG

Paste this into a BLAST search page for me
GAAACGTGGTGCTGTCCTCAGTCAAAATGACACTCCGCTGATTGTTTACCTCCAATATTCACACAAAGGGCCTTTAAGGGCCTTTTGCAATACCGTGACGGCACCGACTAATTTCAACCACATTTAAATCAACGACTCCTAGACTTACCAGAAACAGCCGATCAAGCCTGCAGTCAGCCTGCAGTCCAATAATACATTCGATACATTCGCTGAGTTGCATACCCCAACTCCGATGACTATGGCAATGACATGACAACATTATCTCCAGAACGCCCAGTCCAATGGCATCGTCCTTCATGGGTCCTTCATGGACGGCTTAAGCAATTAACTTCAGTCAATCTCTACACGTG

Full Affymetrix probeset data:

Annotations for 1640589_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime