Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640590_at:

>probe:Drosophila_2:1640590_at:681:89; Interrogation_Position=1004; Antisense; AGTTATTCATGGTGATCCCTGGTTA
>probe:Drosophila_2:1640590_at:240:371; Interrogation_Position=1058; Antisense; GAAGGCAACACTTGTGGATTTCCAA
>probe:Drosophila_2:1640590_at:355:675; Interrogation_Position=1097; Antisense; TAGCCCGGCCATAGATCTCTACTTT
>probe:Drosophila_2:1640590_at:214:669; Interrogation_Position=1116; Antisense; TACTTTCTATTTTACACCAGCCTCA
>probe:Drosophila_2:1640590_at:568:297; Interrogation_Position=1188; Antisense; TTCGACAATCTTCTGGAAACCCTGC
>probe:Drosophila_2:1640590_at:652:175; Interrogation_Position=1204; Antisense; AAACCCTGCGGCATTGCGGCTATAA
>probe:Drosophila_2:1640590_at:212:145; Interrogation_Position=1235; Antisense; ACTGCCCACTTTTGGCCAGTTAAAG
>probe:Drosophila_2:1640590_at:217:257; Interrogation_Position=1295; Antisense; CACTGTAGTCTGTGAACTTCCCATA
>probe:Drosophila_2:1640590_at:573:613; Interrogation_Position=1307; Antisense; TGAACTTCCCATATGTTGTGCTTCC
>probe:Drosophila_2:1640590_at:61:507; Interrogation_Position=1324; Antisense; GTGCTTCCCCTGAGGCAAGTGTTGA
>probe:Drosophila_2:1640590_at:458:529; Interrogation_Position=1354; Antisense; GGGTTCACACCTTCGTAGATACGGA
>probe:Drosophila_2:1640590_at:246:689; Interrogation_Position=1405; Antisense; TATTCGCCAGCGAACGAGTGCGTCA
>probe:Drosophila_2:1640590_at:611:663; Interrogation_Position=1435; Antisense; TAAAGGCCACTCTGCTTATGTTCGA
>probe:Drosophila_2:1640590_at:301:51; Interrogation_Position=963; Antisense; ATGCGAGATGTCGTTGATCCAAACA

Paste this into a BLAST search page for me
AGTTATTCATGGTGATCCCTGGTTAGAAGGCAACACTTGTGGATTTCCAATAGCCCGGCCATAGATCTCTACTTTTACTTTCTATTTTACACCAGCCTCATTCGACAATCTTCTGGAAACCCTGCAAACCCTGCGGCATTGCGGCTATAAACTGCCCACTTTTGGCCAGTTAAAGCACTGTAGTCTGTGAACTTCCCATATGAACTTCCCATATGTTGTGCTTCCGTGCTTCCCCTGAGGCAAGTGTTGAGGGTTCACACCTTCGTAGATACGGATATTCGCCAGCGAACGAGTGCGTCATAAAGGCCACTCTGCTTATGTTCGAATGCGAGATGTCGTTGATCCAAACA

Full Affymetrix probeset data:

Annotations for 1640590_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime