FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640593_at:

>probe:Drosophila_2:1640593_at:468:315; Interrogation_Position=201; Antisense; GCCATTCGACCTGCCAACGGAGGAG
>probe:Drosophila_2:1640593_at:525:389; Interrogation_Position=271; Antisense; GAAACATACGGACCACCGTCTTTGG
>probe:Drosophila_2:1640593_at:46:131; Interrogation_Position=285; Antisense; ACCGTCTTTGGTGGAAGCGCCAGCT
>probe:Drosophila_2:1640593_at:206:669; Interrogation_Position=316; Antisense; TACGGCCCACCGGACCAAATTTATG
>probe:Drosophila_2:1640593_at:242:161; Interrogation_Position=332; Antisense; AAATTTATGGACCTCCCGATCAGAC
>probe:Drosophila_2:1640593_at:655:101; Interrogation_Position=369; Antisense; AGACCAGCCAGCCAATGATGACAGC
>probe:Drosophila_2:1640593_at:488:655; Interrogation_Position=426; Antisense; TAATTTGGCAAGTCTGCCGCTACCA
>probe:Drosophila_2:1640593_at:436:649; Interrogation_Position=459; Antisense; TCAGTATGTTCTGCCGCTTCTGAAC
>probe:Drosophila_2:1640593_at:228:651; Interrogation_Position=543; Antisense; TAAGCTTACGGTTCGTCGTCGGCCA
>probe:Drosophila_2:1640593_at:108:639; Interrogation_Position=558; Antisense; TCGTCGGCCAGATGCGGTCAAGATT
>probe:Drosophila_2:1640593_at:210:53; Interrogation_Position=587; Antisense; ATGCTATTAGGCCTACTCCAGTGTT
>probe:Drosophila_2:1640593_at:242:579; Interrogation_Position=668; Antisense; GGCCATCTCGCCTGATAGTCAATGC
>probe:Drosophila_2:1640593_at:644:241; Interrogation_Position=716; Antisense; AATAGACTACTTCTTTCAGCACTCC
>probe:Drosophila_2:1640593_at:466:697; Interrogation_Position=729; Antisense; TTTCAGCACTCCAAGCAATGTCATG

Paste this into a BLAST search page for me
GCCATTCGACCTGCCAACGGAGGAGGAAACATACGGACCACCGTCTTTGGACCGTCTTTGGTGGAAGCGCCAGCTTACGGCCCACCGGACCAAATTTATGAAATTTATGGACCTCCCGATCAGACAGACCAGCCAGCCAATGATGACAGCTAATTTGGCAAGTCTGCCGCTACCATCAGTATGTTCTGCCGCTTCTGAACTAAGCTTACGGTTCGTCGTCGGCCATCGTCGGCCAGATGCGGTCAAGATTATGCTATTAGGCCTACTCCAGTGTTGGCCATCTCGCCTGATAGTCAATGCAATAGACTACTTCTTTCAGCACTCCTTTCAGCACTCCAAGCAATGTCATG

Full Affymetrix probeset data:

Annotations for 1640593_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720