FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640594_at:

>probe:Drosophila_2:1640594_at:186:17; Interrogation_Position=1454; Antisense; ATTTCGCGAGGCTATCAGGTGGCCA
>probe:Drosophila_2:1640594_at:4:409; Interrogation_Position=1490; Antisense; GACGTCCATTTGGTGCTGGTCGATG
>probe:Drosophila_2:1640594_at:386:637; Interrogation_Position=1509; Antisense; TCGATGTGCGTAAGGCTGGCCTGAC
>probe:Drosophila_2:1640594_at:196:533; Interrogation_Position=1564; Antisense; GGTGGGCATCGCGTGCAACAAGAAC
>probe:Drosophila_2:1640594_at:600:159; Interrogation_Position=1581; Antisense; ACAAGAACACTGTGCCCGGCGACAA
>probe:Drosophila_2:1640594_at:566:711; Interrogation_Position=1697; Antisense; TTCATCGATGCTGCCCTAAAGGTTG
>probe:Drosophila_2:1640594_at:256:549; Interrogation_Position=1745; Antisense; GGCAGTCCCAAGATAACCGATTACC
>probe:Drosophila_2:1640594_at:640:461; Interrogation_Position=1763; Antisense; GATTACCACAAGACGCTGGCCGAGA
>probe:Drosophila_2:1640594_at:149:111; Interrogation_Position=1785; Antisense; AGAATGTGGAGCTCAAGGCCCAGGT
>probe:Drosophila_2:1640594_at:594:97; Interrogation_Position=1815; Antisense; AGATCCGCAAGAATGTGGCCCAGTT
>probe:Drosophila_2:1640594_at:461:581; Interrogation_Position=1830; Antisense; TGGCCCAGTTCAGCAGGAAATTCCC
>probe:Drosophila_2:1640594_at:19:587; Interrogation_Position=1866; Antisense; TGGAGACCCTGTAGGTGCTGCCTGC
>probe:Drosophila_2:1640594_at:451:717; Interrogation_Position=1914; Antisense; TTCGCCTTACGATTTACATCCTCGA
>probe:Drosophila_2:1640594_at:358:151; Interrogation_Position=1929; Antisense; ACATCCTCGAAAAGTCCGCTTGTTA

Paste this into a BLAST search page for me
ATTTCGCGAGGCTATCAGGTGGCCAGACGTCCATTTGGTGCTGGTCGATGTCGATGTGCGTAAGGCTGGCCTGACGGTGGGCATCGCGTGCAACAAGAACACAAGAACACTGTGCCCGGCGACAATTCATCGATGCTGCCCTAAAGGTTGGGCAGTCCCAAGATAACCGATTACCGATTACCACAAGACGCTGGCCGAGAAGAATGTGGAGCTCAAGGCCCAGGTAGATCCGCAAGAATGTGGCCCAGTTTGGCCCAGTTCAGCAGGAAATTCCCTGGAGACCCTGTAGGTGCTGCCTGCTTCGCCTTACGATTTACATCCTCGAACATCCTCGAAAAGTCCGCTTGTTA

Full Affymetrix probeset data:

Annotations for 1640594_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720