FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640595_at:

>probe:Drosophila_2:1640595_at:68:75; Interrogation_Position=1916; Antisense; AGGACTCCGAGCTTAAGAACACTGA
>probe:Drosophila_2:1640595_at:162:159; Interrogation_Position=2015; Antisense; ACAAGCGGCTTCTTCTTAAGTTGGC
>probe:Drosophila_2:1640595_at:15:215; Interrogation_Position=2032; Antisense; AAGTTGGCTGCTCCGGAAAAGCGTC
>probe:Drosophila_2:1640595_at:626:27; Interrogation_Position=2072; Antisense; ATAATCTTTACCTCAACGAGTCCGC
>probe:Drosophila_2:1640595_at:42:113; Interrogation_Position=2114; Antisense; AGCACATGGTCTCCAGCATACCATT
>probe:Drosophila_2:1640595_at:487:695; Interrogation_Position=2142; Antisense; TTTCCGATCCCTGGCAGACTACGAA
>probe:Drosophila_2:1640595_at:425:203; Interrogation_Position=2165; Antisense; AAGCCAGTATCCGTGCTCCAGTTGG
>probe:Drosophila_2:1640595_at:383:629; Interrogation_Position=2181; Antisense; TCCAGTTGGCCGGAACTTTGTGCCG
>probe:Drosophila_2:1640595_at:533:51; Interrogation_Position=2221; Antisense; ATGCTGACCCGTCCGGCAGTAATCA
>probe:Drosophila_2:1640595_at:690:491; Interrogation_Position=2239; Antisense; GTAATCACGCGCAAGGGCCAGGTAA
>probe:Drosophila_2:1640595_at:5:315; Interrogation_Position=2255; Antisense; GCCAGGTAATCGAGCCCATGACAGA
>probe:Drosophila_2:1640595_at:717:497; Interrogation_Position=2306; Antisense; GTCTACGCCACATCGTGGACAGGAG
>probe:Drosophila_2:1640595_at:635:393; Interrogation_Position=2346; Antisense; GAAAGTGCCACCCAAGGCCAAGATA
>probe:Drosophila_2:1640595_at:195:55; Interrogation_Position=2412; Antisense; ATGAACGATTGCCAGTCTCCTAATT

Paste this into a BLAST search page for me
AGGACTCCGAGCTTAAGAACACTGAACAAGCGGCTTCTTCTTAAGTTGGCAAGTTGGCTGCTCCGGAAAAGCGTCATAATCTTTACCTCAACGAGTCCGCAGCACATGGTCTCCAGCATACCATTTTTCCGATCCCTGGCAGACTACGAAAAGCCAGTATCCGTGCTCCAGTTGGTCCAGTTGGCCGGAACTTTGTGCCGATGCTGACCCGTCCGGCAGTAATCAGTAATCACGCGCAAGGGCCAGGTAAGCCAGGTAATCGAGCCCATGACAGAGTCTACGCCACATCGTGGACAGGAGGAAAGTGCCACCCAAGGCCAAGATAATGAACGATTGCCAGTCTCCTAATT

Full Affymetrix probeset data:

Annotations for 1640595_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720