Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640599_at:

>probe:Drosophila_2:1640599_at:198:567; Interrogation_Position=1287; Antisense; GGCAGCACCAACTATCCGGTAATCA
>probe:Drosophila_2:1640599_at:420:493; Interrogation_Position=1305; Antisense; GTAATCAATTGTCCGCCCGTCAAAT
>probe:Drosophila_2:1640599_at:146:517; Interrogation_Position=1350; Antisense; GTGTGGTCCAGCTTGAATCTGCCAT
>probe:Drosophila_2:1640599_at:504:597; Interrogation_Position=1386; Antisense; TGTGCCACAGTTCTCTATCCAGAGG
>probe:Drosophila_2:1640599_at:488:591; Interrogation_Position=1456; Antisense; TGGTCTGGTCGAAATTGCGTGTCAA
>probe:Drosophila_2:1640599_at:440:227; Interrogation_Position=1479; Antisense; AAGGCGCTCAACAACTTTATCACTC
>probe:Drosophila_2:1640599_at:83:699; Interrogation_Position=1494; Antisense; TTTATCACTCTCAAGAAGGCCGACA
>probe:Drosophila_2:1640599_at:246:93; Interrogation_Position=1522; Antisense; AGTTGCGCGGCGTGCGAAATGCTTA
>probe:Drosophila_2:1640599_at:56:27; Interrogation_Position=1611; Antisense; ATAGAGAATCCTTCCCTGATCATTG
>probe:Drosophila_2:1640599_at:214:719; Interrogation_Position=1633; Antisense; TTGCCGTTCGGCGATCATCCAGGGA
>probe:Drosophila_2:1640599_at:576:529; Interrogation_Position=1654; Antisense; GGGATCCCATAAAGGTCATCATCAG
>probe:Drosophila_2:1640599_at:482:277; Interrogation_Position=1687; Antisense; CTTTGTTAATTCTTCTTTCTCCTAT
>probe:Drosophila_2:1640599_at:481:465; Interrogation_Position=1772; Antisense; GTTGTACCACGTTCTTGACAGGTTA
>probe:Drosophila_2:1640599_at:84:169; Interrogation_Position=1833; Antisense; AAATGTTACGCACTTTGAGCTGAAT

Paste this into a BLAST search page for me
GGCAGCACCAACTATCCGGTAATCAGTAATCAATTGTCCGCCCGTCAAATGTGTGGTCCAGCTTGAATCTGCCATTGTGCCACAGTTCTCTATCCAGAGGTGGTCTGGTCGAAATTGCGTGTCAAAAGGCGCTCAACAACTTTATCACTCTTTATCACTCTCAAGAAGGCCGACAAGTTGCGCGGCGTGCGAAATGCTTAATAGAGAATCCTTCCCTGATCATTGTTGCCGTTCGGCGATCATCCAGGGAGGGATCCCATAAAGGTCATCATCAGCTTTGTTAATTCTTCTTTCTCCTATGTTGTACCACGTTCTTGACAGGTTAAAATGTTACGCACTTTGAGCTGAAT

Full Affymetrix probeset data:

Annotations for 1640599_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime