FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640600_at:

>probe:Drosophila_2:1640600_at:459:79; Interrogation_Position=106; Antisense; AGGTACCGCAGTCGCGTTCGCACCA
>probe:Drosophila_2:1640600_at:659:291; Interrogation_Position=120; Antisense; CGTTCGCACCACGTGTATCAACAAA
>probe:Drosophila_2:1640600_at:299:481; Interrogation_Position=134; Antisense; GTATCAACAAACGAAAGGTCTGCTG
>probe:Drosophila_2:1640600_at:210:607; Interrogation_Position=14; Antisense; TGATGACGACAACGATGGCACGAAT
>probe:Drosophila_2:1640600_at:171:177; Interrogation_Position=142; Antisense; AAACGAAAGGTCTGCTGCATGCCCA
>probe:Drosophila_2:1640600_at:586:617; Interrogation_Position=157; Antisense; TGCATGCCCACGCTCCAGATAAAGA
>probe:Drosophila_2:1640600_at:47:323; Interrogation_Position=162; Antisense; GCCCACGCTCCAGATAAAGAGCATT
>probe:Drosophila_2:1640600_at:589:209; Interrogation_Position=178; Antisense; AAGAGCATTCAGGATGCCGAGTACT
>probe:Drosophila_2:1640600_at:314:547; Interrogation_Position=189; Antisense; GGATGCCGAGTACTACATCGAGTGA
>probe:Drosophila_2:1640600_at:530:293; Interrogation_Position=26; Antisense; CGATGGCACGAATGGGCAATGATCT
>probe:Drosophila_2:1640600_at:197:527; Interrogation_Position=39; Antisense; GGGCAATGATCTGGAAAGCTGTTTT
>probe:Drosophila_2:1640600_at:67:561; Interrogation_Position=51; Antisense; GGAAAGCTGTTTTCTCAAAGGCGGG
>probe:Drosophila_2:1640600_at:12:259; Interrogation_Position=78; Antisense; CTGCCGGGAAACGTGGAACTGCGAC
>probe:Drosophila_2:1640600_at:543:583; Interrogation_Position=91; Antisense; TGGAACTGCGACGAAAGGTACCGCA

Paste this into a BLAST search page for me
AGGTACCGCAGTCGCGTTCGCACCACGTTCGCACCACGTGTATCAACAAAGTATCAACAAACGAAAGGTCTGCTGTGATGACGACAACGATGGCACGAATAAACGAAAGGTCTGCTGCATGCCCATGCATGCCCACGCTCCAGATAAAGAGCCCACGCTCCAGATAAAGAGCATTAAGAGCATTCAGGATGCCGAGTACTGGATGCCGAGTACTACATCGAGTGACGATGGCACGAATGGGCAATGATCTGGGCAATGATCTGGAAAGCTGTTTTGGAAAGCTGTTTTCTCAAAGGCGGGCTGCCGGGAAACGTGGAACTGCGACTGGAACTGCGACGAAAGGTACCGCA

Full Affymetrix probeset data:

Annotations for 1640600_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720