FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640601_at:

>probe:Drosophila_2:1640601_at:75:497; Interrogation_Position=146; Antisense; GTCAGGTCTGCGGTTGGTGCTACAA
>probe:Drosophila_2:1640601_at:24:375; Interrogation_Position=207; Antisense; GAAGAAGCGGCCCAATCTTTCGGAT
>probe:Drosophila_2:1640601_at:34:239; Interrogation_Position=220; Antisense; AATCTTTCGGATGCGAGCGTCACCA
>probe:Drosophila_2:1640601_at:176:723; Interrogation_Position=278; Antisense; TTGCAGACAACCCTCGTCAATTGGG
>probe:Drosophila_2:1640601_at:43:249; Interrogation_Position=296; Antisense; AATTGGGTGGTGATCAGCACTGCTC
>probe:Drosophila_2:1640601_at:236:335; Interrogation_Position=317; Antisense; GCTCGGAAAAGAGTTTTGCGCCCTC
>probe:Drosophila_2:1640601_at:153:693; Interrogation_Position=331; Antisense; TTTGCGCCCTCTGGTGACGAAATAC
>probe:Drosophila_2:1640601_at:490:163; Interrogation_Position=350; Antisense; AAATACCCACACCACGTGATTTGAA
>probe:Drosophila_2:1640601_at:635:551; Interrogation_Position=375; Antisense; GGACAAACCTGGTGACCTTGCCTAA
>probe:Drosophila_2:1640601_at:239:657; Interrogation_Position=397; Antisense; TAAGGTCCGATACTGAAGTGGCCAT
>probe:Drosophila_2:1640601_at:651:25; Interrogation_Position=472; Antisense; ATACGCCGGCTGTCTTGAAATCTCA
>probe:Drosophila_2:1640601_at:324:715; Interrogation_Position=55; Antisense; TTCTGCACCCTGTTGAACCATGAGG
>probe:Drosophila_2:1640601_at:147:613; Interrogation_Position=68; Antisense; TGAACCATGAGGTCGTCGATCCCAA
>probe:Drosophila_2:1640601_at:143:215; Interrogation_Position=92; Antisense; AAGAGTTCATGGTGCACTTCGCCAA

Paste this into a BLAST search page for me
GTCAGGTCTGCGGTTGGTGCTACAAGAAGAAGCGGCCCAATCTTTCGGATAATCTTTCGGATGCGAGCGTCACCATTGCAGACAACCCTCGTCAATTGGGAATTGGGTGGTGATCAGCACTGCTCGCTCGGAAAAGAGTTTTGCGCCCTCTTTGCGCCCTCTGGTGACGAAATACAAATACCCACACCACGTGATTTGAAGGACAAACCTGGTGACCTTGCCTAATAAGGTCCGATACTGAAGTGGCCATATACGCCGGCTGTCTTGAAATCTCATTCTGCACCCTGTTGAACCATGAGGTGAACCATGAGGTCGTCGATCCCAAAAGAGTTCATGGTGCACTTCGCCAA

Full Affymetrix probeset data:

Annotations for 1640601_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720