FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640603_at:

>probe:Drosophila_2:1640603_at:153:1; Interrogation_Position=135; Antisense; CAAGGTTACCCCAGCGATTTTCGAG
>probe:Drosophila_2:1640603_at:141:201; Interrogation_Position=161; Antisense; AACGCGATGAAGTCTTTCAGCTGCA
>probe:Drosophila_2:1640603_at:442:365; Interrogation_Position=217; Antisense; GAATACGGCATACAAGCGCTGCGAA
>probe:Drosophila_2:1640603_at:716:453; Interrogation_Position=285; Antisense; GATCAAGGCTTCAATATTCCTCAAG
>probe:Drosophila_2:1640603_at:593:77; Interrogation_Position=350; Antisense; AGGATAGCACCAAATCTTCCGTCTA
>probe:Drosophila_2:1640603_at:232:557; Interrogation_Position=401; Antisense; TGGATCTCCCGGATTTACCCGATTT
>probe:Drosophila_2:1640603_at:416:673; Interrogation_Position=416; Antisense; TACCCGATTTCGGTGGCGTTATGCG
>probe:Drosophila_2:1640603_at:660:693; Interrogation_Position=434; Antisense; TTATGCGGGAAACTAGCCAGCGAAT
>probe:Drosophila_2:1640603_at:193:681; Interrogation_Position=465; Antisense; TATGATAGGTCCTGGCACGGCAACA
>probe:Drosophila_2:1640603_at:709:183; Interrogation_Position=486; Antisense; AACAGGACGTACTGAGGCCCAGGCC
>probe:Drosophila_2:1640603_at:159:89; Interrogation_Position=520; Antisense; AGTAATCCTGGCGAGCTCCAACGAT
>probe:Drosophila_2:1640603_at:16:45; Interrogation_Position=543; Antisense; ATCCTATACGACACTCCACTAGATT
>probe:Drosophila_2:1640603_at:32:481; Interrogation_Position=570; Antisense; GTAGGTTCTAGCATTGTACTCATAG
>probe:Drosophila_2:1640603_at:298:685; Interrogation_Position=652; Antisense; TATCATAACTGACTACTCCTGCTTT

Paste this into a BLAST search page for me
CAAGGTTACCCCAGCGATTTTCGAGAACGCGATGAAGTCTTTCAGCTGCAGAATACGGCATACAAGCGCTGCGAAGATCAAGGCTTCAATATTCCTCAAGAGGATAGCACCAAATCTTCCGTCTATGGATCTCCCGGATTTACCCGATTTTACCCGATTTCGGTGGCGTTATGCGTTATGCGGGAAACTAGCCAGCGAATTATGATAGGTCCTGGCACGGCAACAAACAGGACGTACTGAGGCCCAGGCCAGTAATCCTGGCGAGCTCCAACGATATCCTATACGACACTCCACTAGATTGTAGGTTCTAGCATTGTACTCATAGTATCATAACTGACTACTCCTGCTTT

Full Affymetrix probeset data:

Annotations for 1640603_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720