FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640604_at:

>probe:Drosophila_2:1640604_at:409:127; Interrogation_Position=1433; Antisense; ACCAAGCGGCCGGAGCATGTGCAAA
>probe:Drosophila_2:1640604_at:480:39; Interrogation_Position=1476; Antisense; ATCTGCTCGAGCTGACGCAAAGCTT
>probe:Drosophila_2:1640604_at:723:207; Interrogation_Position=1495; Antisense; AAGCTTTATGATACCACTGGAACGG
>probe:Drosophila_2:1640604_at:12:33; Interrogation_Position=1553; Antisense; ATCAGTCCGTTTAAGTCGGCGCCGA
>probe:Drosophila_2:1640604_at:397:321; Interrogation_Position=1571; Antisense; GCGCCGAATGCCAACAGCTTTAAGC
>probe:Drosophila_2:1640604_at:501:401; Interrogation_Position=1601; Antisense; GACTTTCTGGGCACGCTGGAAACCG
>probe:Drosophila_2:1640604_at:670:371; Interrogation_Position=1663; Antisense; GAAGGGCCTGTACAGACGCTTCTTT
>probe:Drosophila_2:1640604_at:724:243; Interrogation_Position=1697; Antisense; AATTTTCGCGGCTGGTACGGTGCAC
>probe:Drosophila_2:1640604_at:335:355; Interrogation_Position=1718; Antisense; GCACGTCATCGGGAGCTGCAGCTAA
>probe:Drosophila_2:1640604_at:95:685; Interrogation_Position=1770; Antisense; TATCCGTGGCGAATCTCGAGCACTG
>probe:Drosophila_2:1640604_at:723:193; Interrogation_Position=1851; Antisense; AACTGAATCTCTATGGCGACAAAGC
>probe:Drosophila_2:1640604_at:303:525; Interrogation_Position=1888; Antisense; GGGCAACAATGGCTCAACTCAGCAG
>probe:Drosophila_2:1640604_at:375:457; Interrogation_Position=1915; Antisense; GATACGCGCCCAGATTGAGTGCATG
>probe:Drosophila_2:1640604_at:297:283; Interrogation_Position=1949; Antisense; CTGCCGCCGGATCTCAAGAATGTGG

Paste this into a BLAST search page for me
ACCAAGCGGCCGGAGCATGTGCAAAATCTGCTCGAGCTGACGCAAAGCTTAAGCTTTATGATACCACTGGAACGGATCAGTCCGTTTAAGTCGGCGCCGAGCGCCGAATGCCAACAGCTTTAAGCGACTTTCTGGGCACGCTGGAAACCGGAAGGGCCTGTACAGACGCTTCTTTAATTTTCGCGGCTGGTACGGTGCACGCACGTCATCGGGAGCTGCAGCTAATATCCGTGGCGAATCTCGAGCACTGAACTGAATCTCTATGGCGACAAAGCGGGCAACAATGGCTCAACTCAGCAGGATACGCGCCCAGATTGAGTGCATGCTGCCGCCGGATCTCAAGAATGTGG

Full Affymetrix probeset data:

Annotations for 1640604_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720