Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640605_at:

>probe:Drosophila_2:1640605_at:340:259; Interrogation_Position=1712; Antisense; CACCTGCAAGCACTGTTACTATCTA
>probe:Drosophila_2:1640605_at:228:117; Interrogation_Position=1738; Antisense; AGCTAACTGCTACTGAGAACACCGT
>probe:Drosophila_2:1640605_at:630:273; Interrogation_Position=1772; Antisense; CATTCTACGGTGCATCCATCGAGAT
>probe:Drosophila_2:1640605_at:666:353; Interrogation_Position=1813; Antisense; GCACCACATCCTTTGCATTTGTAAT
>probe:Drosophila_2:1640605_at:663:53; Interrogation_Position=1836; Antisense; ATGCAGCCAGATGATGTTCGCCACA
>probe:Drosophila_2:1640605_at:447:569; Interrogation_Position=1876; Antisense; GGCATGGACATTCGGCTCTAAGCAA
>probe:Drosophila_2:1640605_at:283:585; Interrogation_Position=1962; Antisense; TGGAACTGTATTTGCCTGACGGAAC
>probe:Drosophila_2:1640605_at:129:197; Interrogation_Position=1984; Antisense; AACGGGAGACGCGAGATCACTACAA
>probe:Drosophila_2:1640605_at:566:221; Interrogation_Position=2025; Antisense; AAGGTGTATGATCCCAAGTTCGTTC
>probe:Drosophila_2:1640605_at:722:215; Interrogation_Position=2040; Antisense; AAGTTCGTTCTGCACATCGGTAATC
>probe:Drosophila_2:1640605_at:589:41; Interrogation_Position=2055; Antisense; ATCGGTAATCTTCACATGCTGGCTC
>probe:Drosophila_2:1640605_at:302:595; Interrogation_Position=2105; Antisense; TGTGGCCACCGAGTTCCAGGAAACG
>probe:Drosophila_2:1640605_at:548:195; Interrogation_Position=2173; Antisense; AACTGGATGCCGTCTAAACTATGTG
>probe:Drosophila_2:1640605_at:647:631; Interrogation_Position=2209; Antisense; TCCCAGTAACTCACCTTTCGAAATT

Paste this into a BLAST search page for me
CACCTGCAAGCACTGTTACTATCTAAGCTAACTGCTACTGAGAACACCGTCATTCTACGGTGCATCCATCGAGATGCACCACATCCTTTGCATTTGTAATATGCAGCCAGATGATGTTCGCCACAGGCATGGACATTCGGCTCTAAGCAATGGAACTGTATTTGCCTGACGGAACAACGGGAGACGCGAGATCACTACAAAAGGTGTATGATCCCAAGTTCGTTCAAGTTCGTTCTGCACATCGGTAATCATCGGTAATCTTCACATGCTGGCTCTGTGGCCACCGAGTTCCAGGAAACGAACTGGATGCCGTCTAAACTATGTGTCCCAGTAACTCACCTTTCGAAATT

Full Affymetrix probeset data:

Annotations for 1640605_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime