Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640607_at:

>probe:Drosophila_2:1640607_at:120:35; Interrogation_Position=1601; Antisense; ATCACACGCAATATGGCAGCTATCA
>probe:Drosophila_2:1640607_at:396:567; Interrogation_Position=1615; Antisense; GGCAGCTATCATCATGCGTACCAGG
>probe:Drosophila_2:1640607_at:339:487; Interrogation_Position=1632; Antisense; GTACCAGGCACAGGTGCAGTCGCAT
>probe:Drosophila_2:1640607_at:723:551; Interrogation_Position=1768; Antisense; GGAGCAACGTCAGCCACACAAGTGA
>probe:Drosophila_2:1640607_at:730:55; Interrogation_Position=1792; Antisense; ATGAGTGCGGCCAATATCTATTCGA
>probe:Drosophila_2:1640607_at:164:39; Interrogation_Position=1807; Antisense; ATCTATTCGAGCATTGGACAACCCT
>probe:Drosophila_2:1640607_at:629:557; Interrogation_Position=1822; Antisense; GGACAACCCTATGCCCAGGAGCAGA
>probe:Drosophila_2:1640607_at:404:421; Interrogation_Position=1845; Antisense; GAGCAACTTTGGTGCGATCTACCAT
>probe:Drosophila_2:1640607_at:247:453; Interrogation_Position=1860; Antisense; GATCTACCATCATAATGCTGCTGCC
>probe:Drosophila_2:1640607_at:725:313; Interrogation_Position=1891; Antisense; GCCGCTCACTATCATCATGGTCATG
>probe:Drosophila_2:1640607_at:307:161; Interrogation_Position=1979; Antisense; ACAAGCTGAAGGTGTCGCGTCATGC
>probe:Drosophila_2:1640607_at:467:591; Interrogation_Position=2024; Antisense; TGGGCGCCACCTATCCAAGTTTTTA
>probe:Drosophila_2:1640607_at:665:249; Interrogation_Position=2039; Antisense; CAAGTTTTTACGGTTCGGCTGCACA
>probe:Drosophila_2:1640607_at:408:673; Interrogation_Position=2085; Antisense; TAGCTACATAGATCTGGTGCCGCGC

Paste this into a BLAST search page for me
ATCACACGCAATATGGCAGCTATCAGGCAGCTATCATCATGCGTACCAGGGTACCAGGCACAGGTGCAGTCGCATGGAGCAACGTCAGCCACACAAGTGAATGAGTGCGGCCAATATCTATTCGAATCTATTCGAGCATTGGACAACCCTGGACAACCCTATGCCCAGGAGCAGAGAGCAACTTTGGTGCGATCTACCATGATCTACCATCATAATGCTGCTGCCGCCGCTCACTATCATCATGGTCATGACAAGCTGAAGGTGTCGCGTCATGCTGGGCGCCACCTATCCAAGTTTTTACAAGTTTTTACGGTTCGGCTGCACATAGCTACATAGATCTGGTGCCGCGC

Full Affymetrix probeset data:

Annotations for 1640607_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime